Description :
From Genome Similarity Track
Location :
Scaffold_275:17527- 20968
Sequence
3441 bases(100 bases per row)
CGCCATGCTCGCCAGTGTTCAAGCCACCATGGAGCGACATTCAGAAGACTTGAATTGTCTGCACTGCGAGGTCCAAGCTCGGGACGTTTTCATTGCTACG
TTGAACAAGAAGCTGGCTCGCGAGCGCGAGGTGTACAAGTGTTCAATTCGTGCGAATACTGAGCAGACTCGGAAACTTCATCTCCTTCTGGTCAAGCTTG
CCCAGGTCGAGTACGTGGACAACGACACGCTCAAGGTCCTCGAGAACCAGCAAGACCGTAACACTCGCCCCTCCAAGTAAATCTCACCCTCCGTGCACAC
GTGAGTCTGGCCGGGATGGATCCCGAGGTACTGCGTCTGGCTGTTGATGATACGTTCCTAATGTTGCTTTTTCCACCGTGTGTTCAGTAACTAACGTCCG
TTCACAATCATTCGTGATAGGTCTGACTGCGGGTGAGCTGGACCTGGACGCCTTGGACTTGGATCAAGAGACGCTGGTCGCTTTGCAGCTCATACAGTCT
GCTGCCGCGTCTTCGGACGATCCTCCAGCTCTCCCTGTCGCTTAAGCCAAGGCCGTTCACCAAGTGGCCCATGGGAAGTCCCACAAGCGCCTTCGACCAG
GTGGCGAGGATTCCGACGACGAGCCGGACGACCCTGACGAAGACAAGGCTCCCATCCCGACGGACAAGGCCAGTACTTCGATGGCAGCCGCTGGTCTCGG
TGATGCGCCACCTGCCGACACTTCAACTCCCAAGTCGACTCGCAGGTCGCTATTCGGTCCGAAGGCGTGGAAGCAAGCGGCCCAGAAGAAGTGCAAGAAG
ACTCGTCCTCGCTCTCCCGCCAAGTCACCCCGTCGTCAAATGAAGACTCGGTCCAAGTCTGTACCCTCTTCTCCAAGCTCATGGTCGCCACCTCCTACAC
CAACGTCCTCTTCAACTCCCGCCGTGGTCGATCTCAGCGGCGACCAAAGTGACGTGGACATGGTGGATGCTAGTCCAAGTGGTGTCCCATCGGTTCAAGA
AACCGCCACAGAGTCTTCGGGTAAAGATGTGGACCCTGGGGATCACAACGATGTTCCCGGTCCTCCCATCGCGCTTTCGCCCCCGCCTCAGGGTCCTCCC
GATGTGGCCAAGCCACCAGCTTCAACGATATCTCCTTCTCCAGCAGACATACGTGCCGCTGAAGAAGCCCTGCGTGAGGCCGAGCAATTTCGACTAATGT
TCGGCTCAAGTGATGAAGGTGAAGAGTCGGACCACACTGTACCACAAGGCAAGTCTGCTTCGTCGTCTGTTGCGACGTCCAAGACAGTTGAAGTCTCGGG
AGTGGTTTCTACAGCAGGGCCTGCCCCTGTTGAAGCTGCTCCACCAGCCTCCGTGTCTTCACAGCCGGCTCCGACTGTTCCGACAGCTGCCGTACCAAGC
GTGTCTTCGCCCGACTTTTCGATGGAGATTAAGGACGGTGGAAATACTGATGACGATCGTGGAGATGACGTGAATGACAATGAACTTTCGGTGGATGATT
CTCCTGATGCCCCGAGTGGTGGCGGTGATGTTCCGCCACCTACCGATCATTCGAGCACACTCGATGACGAAGATATTGAAGATTCCGACAGAAATTGGAG
CAATCTTGGCCCAGCTCGTCCTCCGACTCCACCTCGGCTAAATCCTTCGCCGATGATGACTTCTCCAATCATAGTCGGCGGTCCGCCTCCTTCGTCACCG
GCAAGTCACCCAGCACCAGCATCTTCACCTCCTGTTCCGGTGTCTCCTCGTCCGCCTATTTGGACTCTCAATGCTGGACCTGGGCGCATGATCACGGCCA
CCTACACTTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCGTTGCCTCACCGAGTGTTGTCTGGTGTTCGCCCTACGGTGCCGGCTTCGTCCAC
CTTGCCACAGTGGGTTCTTCCGTACGTGGACATGGAGTTTACTGACGCAGGCGCCAAGAAGTGTTTCGAGCGACTTTTGAGCTTAACCGTTCCCGAACCA
GCTGGTGAGGTGACCGTTCGTACAACGTTGGAGGGTCTCCAAGCGTACTTCAACTATTCGCATCCTGATCACCCGTACCAGCAACTTCGGCAGCTCTATC
CTCTTCAAGCCTGTCTCTTCGACACTGTCGGCTTCGACCCAAGCGTCCCCATCTCAAAGCGCGCTCCGATGGAGACCCGTCTCAAGATGATCTGGGCGAA
CCTTCGGGGTGACGGCGGTAAGCAAGGTGACCTCGGGTTCGCGTTGTGGGAGCGTCTCCACTGGCTTCCGTTGGCTGGTATTGAACGAGGTCTCGCTGAA
GAAGCTAAAAAGGTTGGCCACGACAAGGAGCGCTTGAAGGAACTGAGAGCTCTGATGAAGAAGCTCTTCAGTGAGCGCGACCGTCGTGCCGATCGTCTTC
GTAACAAGTACCGTGAGCAGTACATGGCGTGGAGTCGTGACTCGGTTTCCTCTGGTACCTCCGGCGCGCCGTTCATTCGTCCCGAGTTGCTTTTGGAGCC
GCCGAAGCCGTGGTACCCCATTGAAAACTTGTCGTTCGCACCTCAGACATCTGACTGGCTTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCCCGGCGT
ACTGGATGAATGAATGCGCCGCATCAGCACCCGTACAACACCACGTACTTCCCGTGCCAGCGTAATCCGGAGATCTTCAATCCTCGTGGTACGCGTTTCG
TGGATGTGTTTCGAAGCGTGCTCGTTGACCCGTGTCTCGATTCTACTGAAGTTATTCTGACCTGGCGTTCGTTGTTTGACTCGCCACCGGCTACTCCACG
TCCCGCTCCGGCTGCTGCTCCTCTTGAAGCTGGTACCGAGGATTCGCAGGGTACGGCTGCAGCCCCAGCTGCTGAGGCTCAGGTTCCAAATGAAGAGGAG
AAGGAGAGTGGTGACTCGACTTCGTTGGCACTCTTGGCCACCGCGGCAGGAAATTGGAATCGCTTTGAAACCTCGCTGCATGTTCCACGACGTTCTCCAG
CATCTCGGCTAACTGTTGAGGGGTCCCGCGTGATTTCGTTTTCAGTGGTCGCTCCTCGGCCGGCATTCATGTTTTCTTATTCTTAATCCACTTCCACAGC
GTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGTTACAGTAACGTTCTTCTTCTGTTAACACAGGCTGCATCGCCTGTGGACAGTTTA
CACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATCTGCAGTCAATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCAC
ATGACAAGTTGCATGCTGGTTCCCAAGTTGGATCTTCATAACCAACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTTGACAGTGGTGT
TCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAA