Description :
From Genome Similarity Track
Location :
Scaffold_217:17523- 19079
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.2Flagellar protein
Pytir_DAOMBR486maker-pir_contig_217-fgenesh-gene-0.1050S ribosomal protein L13

Sequence
1556 bases(100 bases per row)
GCTGGTCAAGTACGTTCGAGCTGTGATCGAGGCGGAAGTCGGTCTGTCGCTGTTTATCAACGCCAAGGTATGAGGATCTGGAGACTCGTTCCTAGGTTAT
TGCGTCCACCTATTGACATTTTACTCTCTTGTGTGTTTCTACCCAATTTGTACAGCCCGAGATCCTGTATCGCTTTCCGATCACCGTCCAGCTCCGTGAA
GACACGCTCATTGACGTGGATCCGCTGAATCGCCTCGTTGCGCGCGCAGCAGTGGACCCGCCGCCAGTGGTCGAAGAGCTCCATCCAGTGCTGCTGAACA
CTCGACAGAGGCAGGAGCTCCTCGAGTTGCTCCAGACTTGTTCGTCTTCGTCGTGTCTAGATGAAAATGGTGGTGAGTCTGGTCCACTTCTGCTGATGCC
GGTGAGCCTCCTGGTGGACGTTATGAGCTCCTTAACGTCGACCCCATTGCTTCCGAAGGCGTGGAGGAGATGCCCGTCGCACGTCTTTGCCAAGGTCCGT
TTGTCCATGGATTTCTGTCATGCAGTGTGGGGCTTTTGCTGCAAATACTCAATGCTGTTTGTTTGTGTGGTGCTTCTTGGCGTGTAGATTTGCAGCCACT
TTCTCGCAAATGACGATGGTGCATCGGGTCTTGTCAATGCGAGTGCGTTCCTCGCGGCCTTGAGTGAGGATGAAGCGCTCCTTGTCGAGGCGATGGCGGA
AGCAGAACAACAGCAGCAAGAACATGGCAACCATGCAAACCATGGAGATACCGATGTGAGCGCAGATAAAGTAGCGTTAGACGAAGAGTGACACGAATAG
ACAAGCAGACAGATAGGTACATCTCATAGCCCCCACACACAACACCACGAGGTGACAAACAGTTCCTGTGCGTGTATTGAGCTGTTAGTTCTTCGTTTTT
ATCTGCTTCCTCTTCAATCGCCTCTCGCCGCTCTCTCATCTGTGGGGAAAGAAGCAATCGATCGACGCTCTCTCTTCACACCTTCACCGCTGCTCTCTTT
CTCTCGCTCTCTCTCCTCTACAGGACGACTGGGTTCTCGCCAAGTTGATCGGCGAACTCGTGCTCCTCGCCCATGAAGATTTTGAGCTTCTTGTCCTGCA
GCGCGCGCATGCGGTTCTTCGGCAGCATGCCGAATACGGCCTTGCGCAGCACCTCCTCCGGCTTGCGCTCGAAGAGCTCCTGGGCCGTGCGCTGCTTGAG
GCCGCCCGGGTGGCCCGTGTGCCAGCGATATAATTTGTTGTTCCACTTGTTGCCCGTGAGCACGATGTCCTTGGCGTTGATCACGACCACGTAGTCGCCG
CAGTCGACGTTCGGCGCATAGGTCGGCTTGTGCTTGCCGCGTAGGATCGGCGCGAGCTGCGACGCGAGGCGGCCCAGCACCTGGCCCTTGGCGTCCACGA
CGTGCCACGCCACCTTCGAGGCATTTGCGATCTTGCTCATGGTTGTCGTCGAAGCTTTCTCTCTCCCTCGAGTCTCTCGAGCCTGCTGTCTGCCTGCCTG
GAAGGTGTTGCCTGCTGTTGCGCGCCTTTGGTCTTGAGCCCCAAACCAAAATGGTC