Description :
From Genome Similarity Track
Location :
Scaffold_1759:1752- 4544
Sequence
2792 bases(100 bases per row)
TTGAAGATTGCATCGTTGCGTAGCCGCCATAGCATCACCGGAGTCACGGTTGCCCATATTCGCCACAGGATAcacacggcgtcgtcgtggtcCGGGGTCC
ACGTCGGGATGCTTCGTTGGGCTAGGGCAAGAAACGCTTATGTCAGTGGTGGGGCCGTCCGCTGTGCGAAGTTCGACTGAAGCTCCATGATGGCTTCGCT
TGAGCATTCCCGGCCAAGCCACTTGGATACCACTTTGTCCAGGAAGTTTGTGCTTTGTGGCAACTCCATATGATATGATCTACCGTTTCCTCTGTGCTGA
AGCAAGTTGGTTCTGGACAGATTCGGTGGCGTGGCCATCCAGCGTCGTGCAGATTGAGTTCTCCCAGCGTGATTATGTAGATCGTCCAGTTTTGGTAGTC
AGTGAGTAGTCCGTGCTGGTCCCACAGTTGGGCAGGACTCTGCCGTAGTGCTGCTCGACCCCAGGATGAACTGTCTTCTCGTGTGTTTTTTTCAGTTTAT
CCAGTCTTTTGCATCGGTTACTGTAGATTTGTCATGAGCGTGTGTGCACGTTACTTGCGGATGACAGCTGCCAATAGCAGTCCGGGTGTCATTTTCGGCA
CTTCCCACGGGTAGACTGATGTCGTCGGTGTCGCTCTTAGCACCAGCCCTCGCATTCGTTCCCAGGCCATAAGCTCTGCGTGATCGGTTGAGCCGGTGTA
CTCCTGAGATGTGGCTGCAACATGCCATGTCTATCCGTCTGGGTTCTTGGAATTTGTTATCGCGTGGTGTTTGCGGCCTTGGAATTCGTGAGTCGCCTCA
ATATCTACACCTGATCCTGTGGCGATCCATGTGAGCTGGATCGTGAAGTTAGGAAGATCTAGGAGCCTTGGTGGTCGTTCTGGTAGATTCCAGTAGTTCC
ATGGGATGCTGTGGATGATGCTAAGGCACCAGTCCAGGATGTGTTTACATTTCGTCGTGGTAGTCCGGTTGGGCATAATGAGCGCGCTGTATTCGGGATC
TGCAGCCTCATTCGTTGTCGGTGAGATGGTAATATCGCGTACACGCCCTGGAAGAATGGTCGGATAATCTTGGATCTTGAGCGGCCGTCCATGTGTATCG
AGGATGCATGCATTATTATCCCATGGTGCGTTGAGAATGAAATCAGCATCCGCCGCAGGCGGGTTCTGCTTGTACGCCGCGGATGTTGTCATGTACACTT
CCTCAGTTCCTACCCAGCAGCAATTACTGACTGTCGGTCCCGATGTCTGTGTTCTACTAATTGTCGCCGTGGTTTCCTGTGATGGTACGAGTATGCCTCT
CATAATTCCAGTTTACCGAGGTGCTGCGCTGATATTTGTGGTTTCCCGAGCCTTTCGCGTAGCGCTGCCGATACCATGCTCGCTGATGTTGGTCTGAACG
CACAACATACTGCAGTTTGGTCCTCATGAGGGTGAACCACTGCATGTCGCGCTGCCGAGTAGACGTCATCCGGATAGTGGAGCCATCGATCTGCTAAGTT
GCTACGAGTTACGGAGAGAGCGCTGGTGATATCctggaggccaaggccaCCTTGCCCTTGGGGTGTGTATACCAGTGCCGGATTGAGTTTGTGCCTGGTT
GGTTCGATCCTGGTAGTGGCTGCCCATATGCATTTTTTCTGCAGTTTCGTCAATGTGTTGAGAATTTCCTTGGATGGTACGAATTGCTTGCCCGTGTAGA
GAGTCGATGGTAGCGCTACAGCATTGAAAAGCGTGACCCGTTGAGCCACCGAATTACCAATGGTAGTCACTATTCTAAGTCGTCGTTGGATATTCTCAAT
CAGGATGGTCCAGTTGATTTCCACCGTGTCGTGAGTGCCGACCCAGTACCCGAGGTTCCTGCCGATGCAAGAACCGGAAACCCATGCCATCTGGTCGGCG
ACTTTGCCGTGTTGAAACCGATCAGTACGCTCTTTTGCGGCTGTACATGAAGTCCTGAAAGTGCTTCAAACCGCTCCAGCAATGATGTGGTGATGTCGAG
TTCCTTGATGGATGCCATGAAGACTGTACTATCGTCGACATATGCTGAGAATATGTGGCAATGTTCAGTAGATCCAGGTACGGGGATCCCAGCGAGTGCG
TGGTGTTAATTGATTGCGTGCGCCAACACATCCACTGCTAAGATGAAAAGGAGGGGGGCTAACGGGCATCCTTGGCGAATGTTTGAGTTGACTGGCCATG
GTCGAGATAGATTGCCTTTCACAAGGAATTAGGCTGTTGTCCCTTCATGTAGCGTCATTATAACCTCGAGAAACTTGCTGGGGAAGCCGTAGCTGCGGAG
TACGAGCTGCAGAATTCTCTAAAAAGCGTAGCATATGCCTTGCGGAGGTCGAGACACAGCACTGCCAGGGAGTCTTCCCACGGAGTCGTTGGGTCATCCT
CACTTATTGCCAGTATCGCCTGTAGCAAGGTGATTGTTTTGTCAATATTACGGCCACGGACAAATCCTGTTGGGCGGAGCTGATGATGCTGGGAAGAATC
GCATGGAGTCTTTCGGCTAAAATTATTCCGAACACCTTGTAGGCGGTGTTGAGTAGAGCAATAGGCCGGTAGTCCATCGCATCAGCCTAGTCACCTTTTT
TTCGGAGTGGAATGATTGTGGCTTGGAGAAAGGACTTCGGCACTCCGCTCCCGTTGAGAATATCATAAACAAGTTCGTCAAGCTTGGAGTCAATTCTGCT
GCAATATCTTTGAAGAAGTCGTGATTGAGCCCGGTAGTTCCTCCTGCCTTAAACCGGGGCAGCTGTGCAATAGCTGCCACTGTCTCACTTTC