Description :
From Genome Similarity Track
Location :
Scaffold_98:17518- 18711
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_98-snap-gene-0.19Endo-1,3(4)-beta-glucanase

Sequence
1193 bases(100 bases per row)
CGCGTCGCGTTGTGACGAGCGGAAACATCACCGAGTACTTCAACGCGGACGTGAGTTTCACGGGGTACAGTCAAAAGGTGTCGGCCGGCGGCAACGAGTC
TTCTCAGAGCCTCTTGCTCGGCGATGGCAACACGACGTCGCGCAGCATCGCTGCCTTTGACCCGCTCTCCGTCACGCTCAAGTACCATTTCGAGAACGAG
AAGCCTGAGGAAGCCGACCACTTGTTCTCGGCGTACCTCGTGCGTGGCTCGCCGTACTTCACCGTCGAGTACCAGAAGATCATCCCCGTGCTTGAACTCA
ATGCGACGCTCGTGGCCGTGAACCAAGAGCCTGTGCAGAACGTCGATGAACCAACGGGGGCGTACAAATCGTGGACGTCGAAGCGATTCGAATTGGACGT
GCAGGTATATGGCGCGGACAAGGGCGCGAATGCTCCACAGAAATGGATCCTGTACTTTGCGCAAGAGCGTACACTGCAGCTGCAATTCGCCAATGAGAAA
GACTACCGTCTTTACAACCTGCGCGGCGAGATCACGACGCCAACGAACGTGCGTCTCGTGGACATGGATTTCTACACGGGACCTGTTCGTGTTGCGATTG
TGCCCTCGGATGAGGCCATCGCGCTCTTGGATGCGTCTGCGAGTGTGTACCCCGTGGCGTCGTCGGTGAACACGAGTGTCGAGGGTCTGAATGGCTTTGC
GACGCTCAACTGGGAGACCAAGCGATTTGAAGGCACGAACGCGTCGGACGCAAATCTGCTCATGCTCGCGAACCCGCACCATGCGGACTCCTTCAGTACG
CATCAGAGTGATGCATCGTTCAAGGTGCTCACGAAGCTGGGCCACCGCACAGTCAAGTCGAACATGANNNNNNNNNNNNNNNNNNNNNNNNGTGCTCGGC
AAGAGCTGGACGCTCCAGGAGACGTTGCCGAACATTGACTTTGACACGACGCAACCCATCGCCAAACCCGAGTACTTGGAGGCGATCAAGGTGTCTCTGG
CAAATGACTCGAACTACACGCCGATCGCCCAAGATCCGTACTTTTTCGGTAAAGAAGTCGGTCGTCAAGCGCGCTTGGCGCTCATCGCGGACACGGTCGG
GAACGAAACGCTGCGGGACACGCTGCTTGACAGCCTCGAAGAGTGGCTCACGCCGTGGCTGGTTGGCTCGAACGACAACCACTTTGTCTACGA