Description :
From Genome Similarity Track
Location :
scaffold_243:17513- 26264
Transcript NameFunction/comments
Pl_107140protein kinase, putative
Pl_107141conserved hypothetical protein
Pl_107142hypothetical protein PHYSODRAFT_507752
Pl_107143hypothetical protein PHYSODRAFT_286438
Pl_107144kinesin heavy chain, putative

Sequence
8751 bases(100 bases per row)
GGTGCGTTGAAGACTCGGTTGTTTACGAGATGGAAGGGGCTGACTTTATGGGTAATTACTGCAGGTGAACATTTTGAGGGAGCTACGCCACCCTCACATT
GTCCGCTATCTGGACCGTGTGATCGACAAGCAGGCCACCAAGATCTACATTGTCATGGAATACTGCGAGGGAGGTGACCTCGGACAGTTCATCAAGAGGA
AGAAACGGGAGGGGTACGCTATTCATGATGCCGATCGTGGAGCAACAGCATGTATCATTGTTGATTCTCCCGGTGATTTCTGACTTTTGTGGATGATTTT
TTTGATGACAGGTCCTACATCGAAGAAGGCTTCATCTGGCACATTTTCACGCACATCTTCCTCGCACTTAAAGAGTGTCATCGTCACCGCGAAGGAAACG
CTATTCGACCTATTCTTCACCGTGACATCAAGCCTGGCAACATTTTCCTAGACTCCAACGTACGAAGCCGTTTTATACTGTTGTTCCTGTCGTATTGCGT
AGCTGTGTATGCGTGTCTGACAGGTTTGCACTTTATTTTCCCATAGAACAATGCCAAGCTCGGTGACTTCGGTCTTGCCAAGGAACTAAGCAGTGAGTCT
CGTTTCGCCCAGACGAACGTCGGTACCCCCTACTACATGAGTCCTGAGATGGTGAACGAGATGACCTATGACGACCGTTCGGACATTTGGGCGCTGGGTT
GTTTGCTGTACGAGATGGCTACTCTATGCCCTCCGTTCGATGCGACGAATCAGCTCGCACTGGCGAAAAAGATTAATGCAGGCAAGTTCACCCGTATCCC
GTCGCAGTACTCGGAGGGTCTGTTCCAGGTCATTCGATGGATGCTCCACAGACAACGCTCTCGACGACCGCGAATTGAGGACTTGGAGCGTGTACCACAG
TTGCAGCAGAGATTACGTGCGTACGCTGCGGCTAGTAACCCACAGCCAGCCGCTGACCAGAACCTGCAGACATCCTACAACCAGAAAATGAAGGAGCTGT
TGGGCATTGAGGAAGACCTGCGCCGACAGGAGGCAGCTTTAATGGCTCGTGAGAAAAAGCTGAAAGGTATGTGGATCAGTTATTACGTACAATTATGTGC
TGTAGATCTAACAGAATATCTATTCATCTCCTACAGAGCTGGAGGTGGACTATATGCGTCGCGAAAGTGAATTGAAGAAGCGGGAGCAAATGGTAGAAAT
GATGACGCGCAAGTTGTCGTATAACGCGGCCAAGGTCGGATCTCCTACAACGTCTGATGACTCTAATTCCAGCGCAGACAACAACTTTGGTCACGGTGGA
CCACAGAGTCCTAAACGAGGCAGCGGCGGGAGCCCCCCAAGTCGTGCCGGTTCAGGTGACCTGAATGCGAAAGTTGCTGCAGAGGAGGTTCCGCAGACAA
GATCTCAGCGTGGCTATCCTGCCAAAGGCCAGGGCAGCCCTTACTATGGCCCAACGGGTGATGTCAGCTCGACTCCGTCGACGTCAAACCGACTCCGTGA
CGCCCCCGAACAAGTCGCCAACTTGGTAAGTCAACTCTCTATAAGAAAGGTCTGAACCTGGTAAGTTCACCCGGTGTTAATTTCTCTAATTGACTTGGCT
GTTTCTGGATTTTTTCAGATGAAGGGAATGTGGAGGAAGAACAATTAGCTGTTGTCAGGCAGCCCCAAACCAGCGCGGGGGTTTGAAGAGCACGGCATCA
GTTTGATCTAGTCTGCGAGACGGAACACGAGCACAGGCCAGGGCAGCGGGGGGGGGTGCGGTGCGACAGTAACGTATTATCTGCATGTGTTTTGCTGTAA
CTAATCGACAATGAAGGGCGCAAACTTAGCGAACGAGCGACCGAACGCCTTTTGTCGATTTTTTTCACCGCAAGCACGCACCGTCGGGCGCCATTAGTAT
TTGTACAAGATAATCAACCAAAAACGCCAAGAAAAAAACAAGCGCGCGGTACCCAGCTGCAGGACCGTAAGCGGCAAACGTGTCACCAGCAAAGACAAGG
TCTGCACAGATAGAGTGTCCGATCAATGTGTGAAGGGCTGACCAGGGACGGAAGCCGAGGGGTAACTTTTGATTCCTGTGGTCCATGCACGCAACGAGAG
GATAAGGATGAGATAATTTGATGAATTCTTTCGTTATGCTTCCAGGTATAATAGTGCTTCAGCGTCAATCCTTGATTAGTGAAGTTGAAGTCACCAGTAA
CTCATACTGTGGGTAGTAGCTCGGGCTGTGAGTGGTGAAGTGTGAACTGCACATGCAAAGTTCCCTAAAAACAATTTGGTCCAGGGTCCTTAGGTTATCA
CTTGACATCTTCTACTTCGGACTTATCGTCGTCAATTTCCGTCGTCGTTGTCTCCTTTGCCTCAACACGAATCTGAAGCAAGGCTTCAACTGGCGTTCGG
CAAATTGGACATGTACTGGAGCTCTTCCGCAATGCTTCAGCGCATTCGCTGCAGAGGCACATGTGCCGACAAGGCAAAACTGTAGTATTGCGCGGTTCGC
ACATGCAGATGATGCACTCTGCGCCTTCAGGATTTTCAATCTCATCCTTAGCAGTTTGAGTCGTGTCAGCTTGGCCATCTCCAGCTGCACCGCTACGCTC
TGTCTTAGGCGCTGCTGCTACCGAGCCATCAATGCCATAGATCTCCTGTAATTCGTACGTCAGTCCGTCCACCTACTCGATTAAACAAGCACAAGAGTCA
GTACTGCCGAGTTCGTATGCCTATCCATAACTGGAAAATACCAGGATTTTTTGCTTGAGCATTTTGATATCCCACAAGTCTTCTCCTTTCTTGACGAATG
TGCAGAATGTCGATTGAGATTGTGGGTGTTTCCCTGTCAACAACATAGCAACCAGCAATAAGATGCCAACGAACTGATGTGCTTACCAATGCATACTTAC
GATCCGAAGAGACTTCCAGCACAATGATCAACGGAAACTGTGTCGTGCCTGCCTTATACACCAGTTCGTCGGAGTCGTACGATGAGAAGTCCAAGAGCGG
CGTAAACTGCTCATGTTTTTCGTGGTCCTCCCTCTCTGCCTCCTCTTCCTTCATACTCTCTTTGAGCACAAAGTTCTGCCCCAAACCCGAAGAAAAGTGC
TGTGTCAGCACCGGGATCTTGTCTGCATGGACCAAGCCAAAGCTGGAGCCGCCAGTTTCGGTATCAATGGTCTCCGCTGCCACCAAATACACACTAATCC
GACATGGCTTGGTGGCATCGAACAAGAATTCCAGTCCGTACTGCAATGGCTCCGTAGGCGACTGCTGCAATTTAAGACTAGTCTTCTTAAGGTTCACGTG
GTTCTTAACTGTACACGTTTGTTGTAGCTCGGGGACATCGACGGGTGTGCGTGTTTGATTGGACATGAACGCCATGTCCGGTCGACCCCTACTGAGATAT
AGTGCCTGCATCTGCGCCGGTGTGTAGCTCCCACGCGGCGCTGTAGCTGCACCTGCGGGTTCCCCATACAACGTCCCTGTCGAGCTGCGTCGCTGCCGAT
TCACGCTCGCCGTGTGCCCCATGGTGTCACGTGAAGGGTGCCCGATACGTTTTTTTAGTTATGCCAGGTTGCTGGGATTTCGTATTTTATGCCTAAATTA
GCGTATTAACAGTGGAATATGGCGAGCAAGTATTGCTACTGCTACTGCGTCGATGCTTTATAGTCTTCTGCCATGCCCCATGCATTGGCGCCTTCGTCAG
CGTCGGCATTCCACATGAACGAGTTAGCTCCAACTACAAGAGCAAAGCGACAATTTTTTGGTTAGTTGAAGTCGTGGCCCAAACAGATACAGCAAGACAG
ACGTACATTTGACGCCTGTTGTTGGAGGACACCCGCCATGAAGACTTGTTGGGTCCACATCGTTCATTGGTGTTTGGGAGTAAAACAACGATGCTGTGAG
CTTCACAGGTGGTACTGCAAGACCATCGGAACACTCTGCCATGCCTTTCCGCTCGATTCCAGTCACCAGACGCTCCTTTGAATACGGAAATACCGTCTCA
CCACCTTCGTGGCATTCATTTAAATACAGGAACAATGTCACGAATCGATTTGGCTCAAAGTGGTGCAGGTACTTTGGTTTCTCGTAGGCGAACAGATCGC
CAGCACGCTTGGTCCAAGATTCCACTGTCAGGTTGAATGCAGCAGCACTGTTACGTAGCAACTCCAGCAAAACATCATCGTTTTCTTTGTTTTCAACTAG
CCATGCGTATAGGCCCTTGGAGAGCGTCTCAACCAGGAAATCTTGAGTGTAATCTTCGAGGATGTGGTTCACCAAGCGATTCTGAAAGCTCATGTAAAAT
GTCGGGTAATCTTTACCTTCGGGTCTCACACGGCTTGGAACAGCGTCCGCTTGCGTATCCATCAATTTTTGCACACGCTCTTTCGCACAACGGATCCATC
GGAAGTAATGCGAAATGCTACTAATTGGTGGTTTGGGAAAAGTATATACAAGCTCAGGCAACCCAGCACGCTTCTCCCATGAAGCTATGATAAAAGGCAG
CATGTAGCCTTTACTCTCCAAAATCGGTCCCATGATATCATTTGCTTCCCGTTCAAGATTTTCGTTAATCCAATCTCGCCACTCCAAGTCTGCGTGTTCC
CAGAAGAAGTTACTTACTTCAGCATCTTCCACGAACCCTTTCAGTAGTGCATGATGAAATGTCAATGTGTTCTCTATGTCAGGGAACATCGAGCCTCCAG
GCAAGAATTCAACGGGAATAATGGTGTCACCATGTTCCTGGTAAATCCTCTCGATTTTGGCCGAAGCCCATTCAATCCATGCCTCAAACTGGCTTGGGGC
CAACAACACATTTGGAAGGAACACTTTTGAGTCAAAGTAATCCTCGTGTTTGCGGAAAAATTGACCTGCTTCATAACGTACAAGCTGCATCCTCTCGGTA
TAGCCCGGAGATGGCAGTCGAGCAAGACGGGCCGATCGCACGCGAAAGTCTCGCGTGAAGTTGGTGTCATTAAGAAACGCCGTGAAGCTAGTGCGGTCCG
CGTGGTATCCATTCTTTGCGTCGGTGCTGTCCACTAAAGATAGAGAAAGGTGATCAATGCCCTCGGCAATAATTATATCAGCTTCCTCCTGCGTAAAGAA
CCCTTCCACTGTGAACACTTTCGGCTGAAGTGATTGTGTCGTGACAGTGCAGCCCTCAATCTCACGTACGTAGCCCACCTTGATTCCAGGCCAGACCCAG
AGCTGTCCGTCCAGCAGTACATGCGCAATACGCAAGGAATTCAACTCGTCTGCCGTGAGGATCGGCAAGCCGTCGATGGAAAAGAGCTTCAGACCATTGG
CCAGCCGCTCCGGGTCCACTGCCAGGTGCAATGCTGCCGTCTGTGCCAGCTCCAAGAGACACGCTTCCTTGTCCTGATCTCGGATCCAGCGCAAATAGAT
CCCCTCGTTCTGCCCGTTTAGCATGAAGAAGACTTGATTCTGGTCCCGTAGCTGCTGCTCCCGCCCCAACACCAACTCCACATGCGTCAAGCTTTCTTCG
ATTAGTTGGAAATCTGGACATTTAGCGTCTACAGACGCAGCAACCAGCAGTGGATGCAAAGCGATCGTCACGATTTCACTCTCATACTTGTCCACCAGCA
CTACAGACGCGTTCGCGCTAGCAAATCCGATATCGCCGTAGCCGAGTCGCTGCAGCAGCCAATAAGGCGACGTCCAGACGGCCGCAATCACTGCCAAGGC
TGGTATCACAGTGAGCGCCACGAGATTCCTCGACAGCATACTTCAATTGGCATTAATCCAACGAATGACGGTACTGCTTAACTGAGGTCTGGCACACAAG
TGAGACAAGCGCAAGTGGGATGCGTCACTTTGTTCAAAGGGCGTCGACGTGGGCAGTGTTGGACGTTCATGATTGGCCAGATTTTAGCATTTGTGATTGG
CCAGATTCTAGATAGAACCAGGCTTGTGTGTTCTGTCTGCTACGTTTCTAAGATCAGAAACGAGTTTCTAATCTTTTCTCCTGCGGTTTGTATCAAACGT
ACTTAGCAAGGTTAGAAATGCTGCGTCATAGGCTGGTTCTAAATCCGCTGTTACAGGAACATACAGCGTCATCCCATCGAACCAGAATCTTGTAAACGTC
AGTAACGGCCACTCGCCATTTCCGCTTTTGCCGCTTCGTATCAATCTCCACTTCTACTCGATGCAATCCGCTATGCTCAAGACCTGCAGTCGCGCTGTCT
CCGCCGGCCACATGCGCTCTGCGCGCGCGCTCACGACGTACTCGGGCGGCCAGCCTTCCGAGGGCCAGGGCGGATTCTACGGCTCGGCCAAGACGCGGTC
GGAGGCCAACTCCAAGTTCAGCCCCGGCGCTCGCGCCGAGCCGCAGGACCTCACCAAGCTGCAGCAGCTCATGAAGCAGTGGGAGACGCAAAAGACGTCT
CTTGCCGCTGAGGAGCAGAAGAAGGCGCTGGCGCAGATCGCCAGCGAGGAGGAAACGCTCATCCAGCGTCTGCTCATCCGGGGCGCGCCCGTGTGGGGGC
TCTCCACGCAGCAGCGCCAGTTCGTGGCGGAGTGCAGCAAGGCCAGCCGCTGAGCGCTGCGTATCCAGCTCACCGAGCGTCTGTATCCTGTGCTGCCGAA
GTTGAGGGTTTCGTTTCGCTCTCGATCGACCCGCTCTCTATATTGTTGTCGGCTCAGCGTCTCGGAGGAATAAAACGAGATATGAGCTAGGAAGGCAGAG
TGCCGGTTAATGTATCAGTTCCTTGACGACAGTTCGTACAGAAGATAGCTCGTTGATAATTATGATTAGCGTAGGAATGTGCTTGCACGAGCGAAGAGTA
TTAGCTCAGTAGCGCTGCTGTGATGCTGCTGGAGTCCACATACATGCTTCCGCATTCGAAGCGAAGCGAATCAACGAAGCAGACATACGTGATTCGTGCG
GATGATTTGTAGTGAGCATCCAAGCAGACATCACAGAGAATATGAGTCATGAAATGACACATTCCTCGAGCGGAGAGCTTGGCGCAATGCTTGTACCGTG
CGCTTCACTAAAGAAGCGCTGGTGGTACCAGCGAAATGTGACGGGCTTTGACGCGTCACATTTGGTAGACTTAACAATCAAGCTGACGTTCATCATTTTT
AAAGCGCACACATAACCACGCTCTTACATGTTTAGCCGCGTGACTGACTTGACTGGCTGGCCGTCATACGTTGCCAGGTCCAAAGATTGCTGACGGCGCA
TGTTTGACAACTGATCCACTTGCTCGGTTGTAGACGCCTCTGTGCTCACCGTTCGTCTCAAGGTTGGCGGCGCAGCGTCGGCATCCGTGTTAGCGGACGG
AGCTAGTAAGTCCGATAGAGCAGCCGGCGCTCCAAGTTCGCTGTCATGATTTGAGCTAGACGCGTCCATCAAATACATGCGCAACGTCTCCAGTTGAACG
CTTGATGGCGTGAAGGGCTTCGTTGGCGAGAGCTTGTCTCCATCCAGTTCCACGGGCGGAGATTCCATCTGGTCTTCATCTCCGTCTGAATCAGCTTCTT
CTTCAGGTGTTTTCTCCACAAACCATTCCGTCTTCAGTGAAATGTCGATGCGCTCACTAGATAGCGCACCAAGCTGTGCTACTAACCGCGCTCGAATATC
GGGATGCAGTCCACTTTTAACGATCATCTTATGATAGATCTGTTGCGAGCGTGATCCCGACACTATCGCGCAAAGCCACTCCACGACGCGCCGAAACTGA
ATGACGTTGTCATGGCATATATGATGACGGAATAGTTCCAAGAGCTCCGGGTACTCGCCAAGAAGGCGATACTTCTGCACTGCGCGTTGCTCGACGCGGC
GACACAGCTCATTACTAAACTCGAATCCGTGAACCCCTGCAGCGTAGCAAGCATCACACAGCTCGTATCCATCACAAACATTACATTTCCACTTTCCACC
GACGATGGGACTCATGCCGCAACCATAGCACAAAGCATTTTCATGAACGTGCTTCTTGTGGTAGCGGACATTAAGACGGGTTTTAACGTCGCCAAGCAAC
CCTGCACCCGCCTTTGAACGCAATCGACTAAACACTCCACCGCTGCTCGAACTGGATCTAGGAGCACCAAAGGCATCAAACGGGAGCGACGGTCGACGAC
GTAGCATCGGAGCACTGTGGGGTGTTTCCAACATTGAGATGGACTCAGTAACGCTAGCACTCAAGTCTACAGGCTCAGACGTAAACCGGTCTTTCGTCGG
ATCCAGCACTCGGCTTGTGTGGAGCACCGACGGGCTGGAAGCGTCGCTCTTTGGGCCATAGAAAAGATGGTCTTTAGCCCACAGAGCCGCAGAAGTGCCA
TCAGCAGTTCCGTCGTCACTAGCGGATTCACCATATGTGCCTTCAAGTTGCACTTCATCCTTATGCTTGTGATCAAGGCTGATTTTCAAGTCTGAGACTC
GAACGTAACGCGTGCGGACGTAGGATTGCACCTTCAGGTCGTGGCGGTTCTTCAGTAGCGGTACGATCAATCGTCTCATATCGCGATTTTTCTCTTCGCT
GATGCCTTCAATTGAAATCTCCGGGTGAAAGTTTGATCGAATATCCCGTCCTTCTAGCACGAAGCCCAACCATTTTGAAATCTTCGCTCGGCCTCGTTCG
GGCATGCCCCGAATTAATCGCTTGACAACCTCAGATTCCATGTCGATCGGTGCAACTGGAAACACCTCATCATCCAATTTCCAGTCGCTGTGAGATTTTG
AAGACTCAGTATCGTCTTGATGCCGACTATTAGGTCGTGTGTGCGAATTCG