Description :
From Genome Similarity Track
Location :
Scaffold_2206:1751- 3717
Transcript NameFunction/comments
Phyta_totarag14243hypothetical protein

Sequence
1966 bases(100 bases per row)
cgagcagtgctcgagtGCATGCGCACCAGCAAGTTGTATGCCAACGCTGACAAATGCGTCTTCGGCGCGGAAGAAATTCCGTTTCTTGGGTGCTTCATTG
GGAAGCGAGGCCTTCGAGCGGATCCCGCCAAGGTTAAAACCATTGTAGACTGGCCGGTTCCAAAGAACCAAAAGGACTTACGCAAGTGGTTAGGCCTCGC
TAATTACTTGCACAAGTACAGCGAGAATTATGCTGAGATGGCAAGGCCATTGTCGAATCTCCTTAAGAAAGATGCTGAGTGGTGTTGGGACACCGAGCAA
CATGGCGCCTTTGAGGCGATTAAGGAGAGCCTCCTTCAGGCGCCGATCCTGGCGCTCCCGGACCCGGACTGTCCGTTTAGCGTCGTGTATGACGCGTCCG
ACTTCGCTATCGGATGTGCATTACTTCAAGCGGACTCCGAAGGGCGCGAACGCGTGGTCGCGTTTGAGTCTCGGCAGctcaaggctgctgagaagaACTA
CCCAGTTCACGGCAAAGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCAGGGTCCACCTGCTCGGCTCCAAGCCTTTCGTGGTTTACACGGACCAT
GCGTCATTACGCACTGCGACCCAGTCGCCTCACCTCTCTCAGAGAATGGCCCGATGGCTCTCCTTCTTTGTGGAGTATAACTTGGAGGTGAAATGTAAGC
CGGGCAAGCAGAATGTCCTGGCGATGCGTTATCACGCAGACCGGACTATGAGCTTGCTCATGTTACGACTGTGACATCGTCCGTGACAGACTTGATTCGT
GCAGCTTACGCACCTGACGGCACTTACGTAGCCCTGCTACATGATCTTGGGAGCAAGGAATTCCCCGATTCAGACAGGAAGATGTCGGCGTGCTCTCGCG
CGAGGTTACATCGATATACCCTCGATGATGGCCTGCTGTATTACAGCACAAGCTCAGCTGACACGCCTCGCGTGGTGGTCCCTCATGACGAGGACTTGAA
GTATCGCATCCTCTATGAGGCCCATGATACCCCACTCGGTGGCCATCTGGGTCGTGAAAAGACCTACAGCGCTGTCAGCACGATGTACTGGTGGCCGAAG
CTGTACANGCATTGTGGTCTTTGTCGACCGGCTGAGCAAGATGGCTCACTTGGCGGCTGTGCCGGACTCCGTGGACGAAGAGGGTACAGCTACGCTGTTT
CTCGACCGTGTCTTTCGACAACATGGTCTCCCCGAGACGTGCGCTACAAGCTGTTCAGCATCCTTGTGGACGACGTTTTCGGAAAGGTAAGGGAAGTTTG
TACATCATATTGTACCGAATATTGGTTCTGGTACCGGATGATACCTGACCTTTTGTATCTATTGTTTGTAACTTCTTGTAGGGCCAATACGTCCATCACT
CGCTCGTTGAGAGTGATACGAAGGAGGACTTGTCCGTTTGCTTGGCGGAGTTCAAAGAATCGAATCCAGCGTGGGAGAACATACGTGTTATCGTTACGGA
CAAGGACTTTAAGGAGAAGGACGGGTTAGCTGAGACATTTCCTGCCGCGCGGCAACTATTGTGTCAATTTCACGTGATTGACTACCTCCGCAGACAGGTA
TTCGTTTGGTGTTGTATGCATGGACTTGTGAATGCGTGCTCATGCTACGTATTGGTTGTTGGCAAGGCTGgaagtcgatgcagtcgcggtgctgaagaca
agaaggaagTCATtggcgcgctgctgttgatgatgaaggcTGAGAGTGCGCAAACGTACAAGCTGTACCGCCAGGACATGCTCCGGTCGCttggcaacaa
caagaaaTACCCCTTTttcgagtacttcgacgCAAACTGGGAAACGTGCAAGCAGGAGTGAGTTGATTATCACCGGGACAACGTCCCTCATCTCAACAAC
CACACCAATAATCCGATTGAGAGCGGCTGGGATaagatcaagaaggtggtCGATCGAGAGGATGCG