Description :
From Genome Similarity Track
Location :
Scaffold_292:1751- 3108
Transcript NameFunction/comments
g17491.t1OWZ00629.1 reverse transcriptase [Phytophthora megakarya

Sequence
1357 bases(100 bases per row)
TCATCACCTGCTTGCATTGTTTGGAAGCGAGCTCTCGCACGTGCACCTTGGTTGAATTCATAGAGCAAGGCACCACAGCTCAGTTGTGTCACTGGTAACC
ACTCGGGTTCATCATAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGCCTGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAAC
TTCATACTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAGTGCAGCATCAAAGTCGTCATCTTCATTCACATTCAACTCCATATTCGGG
CGTTTTGGAAATAGAGCCCGGGGCTTCAGACGACTGATGTGCACCCAAGGGTTGACGCGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCAT
CATGCGCTTCTTCAATTCGGAAGGGGCCATGCCACATGTGGGCCAACTTTCTGCTCAGTCCAGGTTGGACCTTCGGAATGTACAACCACACCAGGTCACC
CACTTCGAATCCGGACTTCAGTCTGTCGGAAAGTTCTTTCCACTTCTGCGTTTGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCA
CATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAGCGGTTCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATA
ACGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCGAGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATG
ATCGTCCCAATCGCTCTGATCCGCTTCCGAAATATACGCTCGGATGCTCCTGACCACCGTCTGGACGGACCGCTCCTGTTGACCATTTGCCTGGGGACGA
TATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAGCGAGTGAACACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGTAACATCGAAC
TTGCTCCAAACCTTCGGAAGACGCACTCTTCATAAGCTTCCGCTACGTCCTGAGCTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGC
ATCTTGGAACAAAAGCAAAAAGGTGTTCCCACGCTCGGACTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATG
TTTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATCCCAGGCC
AATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAGTGACGCCTTGATGGCCGCCCT