Description :
From Genome Similarity Track
Location :
Scaffold_64:175091- 176587
Sequence
1496 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNCCGGAGAACCAGCTGATGATGCTGCTGTCAAGGGGAAGGTGTAGCAGACTGAGGGGCCGTTCGAACCCTCGGTCT
TGCCCTCCCTAAGAAACACGACGAGTAATGCATGCTGATGAGCAAGGCGCCGATGATTCAAGAAGAGGATGAGCTGACGTACCTCCAGCTGTTCACGTTC
GCGACGTCGGCGAGGGTTGCGACGCAGAAACACGTCGGACACGGCTCGGTTCAAACGCTTGGACATACGGTGACTGGATGGTGAATTGGAGAATGAAGAA
ATGTCACAACGGGCACTAGTACCGTGGCTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTTCGTAGGCGCGGATTATCACCCGTCGACAAAGA
CGTGACACCGCCCAAGATGTTCAAGCGACGAACCCTCGGTCATGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACTTCCGAACTTTC
AACGAGTATTGGATACGGCCCATATGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGACTCGCATTCAGCGGACCATCTACATTAC
GAACCCTCAGTGGCGGTTGGGATGAGTTCGCGGAAGACTCAGCGACCTTTGGAAGGCACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATACTC
ATGCGACGGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGACCATTGTTCACTTGATATGTGTATACTTGATTAGGACTTCTTATTAGGAATA
GACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTCTTTGAGT
GTGTTATGCCTGTCGGTGAGCTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGATTACTATCGGGAGGTTTTAC
GTGACGGCTTATTGTTGTCTATTTGCACGACTGGGATTGCTTGTATCGCATCCCTTTTATTCTTCCAACCGAGTGTTGAACACTCGGTGCCCTCGTAAAA
GGCTTTCCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGATGATCAATAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGG
TTGGTCTATATAAGTAGTTTACAAGGTCCAGTCTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTTAGGTCCGACCGAACGATCGTTTACTATCCTAGTAG
ACGTATTGTTGTGGGAACGTCCTAACTACATTTGTAGCTAGAGCTCACGTGGGAATTCCAACACCAGAACTGGTGCCGCGACCCGGGAACAGATTGTGAC
CATTGTGAACTGTTTGTATGGCCTTCCCGTTTACGAGCTACCAAGAGAAGAAGAACAAGAAAAAGACAAGAAACATGGCGAAAGAACAACCGACAG