Description :
From Genome Similarity Track
Location :
Scaffold_206:17505- 18985
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_206-snap-gene-0.18Conserved gene of unknown function

Sequence
1480 bases(100 bases per row)
AAGaGAGCGCTTCGCCTGTTTGGTTACAAGCAGAAGACGATGATAGAACTCACGAACCCGGCACTGGAAGAGGATCCGTGGGTGTGTCGCCCTGGGGTCT
TGGCTTTGATGTTGTCTAGATGGACTCCTCGTGAGCGGTCGGTAGgTGGGctctcTCACAATCCGTGTTTcTTttACTCTGAtATTTTGtCTGCTGAAGC
GGTGGCGGAACTtCTTTTTAGAGATGCGACTTCAGAGCTACGGGGCTTTGCGAAGACTTCGACGTCGAGTGTCAACGTTCTTTGATTGGACGCGGCGTGC
AGCTATGACTGGCCTACTCAGGGCGAGTTGTCTTCAGTCAACGCCTGAACGCGAGCTTGGAGATTACGTTCTGAAACTCGAAATGGGTCCGAGTTTTACA
ACTCATGCGGCAATCAATGCGACTTACTATAGTGACGCTGACTGTACGTAACCCTtTTTTCGAGCTGGCATGGCGCCTTACTCAGTCTGCACTGCTTTTG
TGGGAGACAGCGGCAGCAACTTTGCATGAGCTCAAGTATCTTGAACGAGGCGCCGAGTGTTTTgcTTACATCGATTTTCAGTGTCGAAACGGCACGAGAG
GTACGTTgATGAAACCCGTTCAAAGATTTGACTCTGACTTATTCTTCTTTTGCCGAAGAATCCGATGCATTGTGGCTCTGTCAACGGCTTACTGGTTTAT
TGAGCTCTATTTCAAAGATCACATCGAGTTGCTACCCCATTTCTTCAAGTGGTTCATCACAATCCCGACCAAGATGCAACTGCGATCcACAGGTGGCGGA
GCCTCGTCAGGCTCCGGGACCGCAGCAGGAGCAGCTCCAATTGTTCGGATCGTGATTTTGTTCACAGGAGAAATGGATGTTTACACCGTCATGCAAAGTC
TCAACCTTCCGTCGTCAATGCAATTCGATCACTTGCTCCAGCGACTGTCGACGCGCTGGATGTTCAGTCATTCGATTGAGGAAATCGTCACAAATAAACG
GTTCGTCGCTGGAACGCAGTGGAGCTGCCGCGGTCAACTCGATATTCGGTTCAATCGCCAGGCGTGTGGCCAGATATGTCGACAGTCCGCGATGAAAATG
GATGATGAAATTGCAATGCAGAAGGAGGAAAGGGATTTTATGGCCCAGCAGCATGCCGAACAGGACGACAATATCACAGGCAAAACGGCCCCTAAGTCGT
TTCAGACCCATCGTGAAGGTTTCGAAGAAGATGAAATGGAGAACTCGTCATTATCATGGCGCACCTGGTTGCACCACCTAGCTGCAGTCTcGgATTCATC
ACGAGAGCTCAGCTTGACATGGTCATTTACGGACTTGAAGATTCTGCTCGAAGACAACGCGTGGGTCAAGACCATTATGACTCCAGTGAGACTCCAGTGG
CTACAACAAgTAGTGTCAACCGCTGGAGCGCTTGCAGGGGAGTGGAAGCAGTTGGGAGAGTCATTTCGTGCAGACTTCGC