Description :
From Genome Similarity Track
Location :
Scaffold_1584:1750- 4094
Sequence
2344 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGA
TCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACTCC
ATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCTCTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATAGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAGGTCGGATCGACGAGGACGCTGCTGAATGAAACAAGATTCGCGGATCGATGGAGTTTTGGGAGGAATTCTGTCGACGGAAGAG
AGGTGGATCCGGATCGGGATCTAGGAGAGAACCCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGGTCTTGACTTGCGTCAAGATCCGCTAAC
AAAACAAGGGAAAGTGAAGGCGAAACGGCATTTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAG
AAGACAAAAACGAGTAAGACTACGCGGAAGAACATGCAAGCCCCAGAGTCAGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCG
AGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATACAAGGGAACCGGT
GAGAGCTCCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTTTGTTCGACGCAGAG
GATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATC
CAGTGTCGTCGCCGAGGATCGGGCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCCGACACGTCGTCCGAGCCACGACGCATGACTTT
AGGACCCTCCGAGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGT
GATCTGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGACTCAAGGTAATCGCCTCACGGATCATGTCT
CGCCAGTGGACCAGCCGGCCACAGGCTCTTCCGACACCTCCTCGGACACCCTGCAGCGACACTTCGAAGCTGCGATAAGTCGTTTTCTGGCCGAACAGGG
TATGAGAACGCCCGTGCCACAAGCGCACGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTC
GACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCT
CAGCCATATCAGATCTGAAGGAGTTCACGGGCAAGGATCCAGATGAGGACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATG
CTGAGAAGTGTTTGACCTTTGCGGATCTGTTAGCGGAGCCAGCCAGGAACTGGTATTGGCAGCTAGGCAGATCCGCCAGGAACAAGTGGCCAGATTTGCT
GCGAAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTA
CATCGACTAAATGCGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGG
GAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCA
GAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTC