Description :
From Genome Similarity Track
Location :
Scaffold_2131:1750- 3500
Transcript NameFunction/comments

Sequence
1750 bases(100 bases per row)
CTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGAC
GCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCC
ACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGG
AGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCAACCGACCAAGCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGCCCAAGA
CCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCACGACCGCCCGCATCAACAAGTTCAACGGAACCAACTTCCACACGTGGAAGTTCAAG
ATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGCACGACCACGGCGGATCAAGCGACGTTCAAGA
GGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTACTTCTGCGCGAGGTGTGATGCTTGCTGC
GATCGCTCCCAGAATTTCATCCTCGCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGAAGC
CAGCCGAGTTGACCAGCCACGCCAGCGTCGATTGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAG
TGCCAAGACTTCCTTGTCGACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGT
ACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTAGACACGATCTTGG
CCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTGCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCT
GTTCTGCTGAATCATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAA
CTTCCAAGGAAGGATTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATATTTCGGATGGGCTTCCAAACCGTCGACGGACA
CTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAAC
CTTCTCACACAGCATGTCCCACGTGATCGCAGTCACCAGAATATCATCGA