Description :
From Genome Similarity Track
Location :
Scaffold_1158:175- 4349
Sequence
4174 bases(100 bases per row)
TCGAGGCTTCCCACCTGTCCTCCCGTCGGCAGCCCCCTTGCGACTTAGTCGCACCCGTGGGCGCTCACCCACCAGGCTCCGCCGCCTCCGAGTTCTCGTG
CGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCCGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTCGTCGACTCACGTCGTG
TCCGGGTAGCCCTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCACCCTTCGCGCACGTTCACTATCTTCTCGACCTCGAAGA
CGTCGTCCTCCAGCTCGCGCGTGACTTCCCAGCTATCCTCCGGCAAGAGCTCCACGTCGAAGTCGAAGCGCTCCTCGGTCGGCACCGCCAGCTGCGTCGC
GGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCCTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGTCTCGAGGCGCACTGCGAAC
GCGCTGACCAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGGGCGAGCTTCGCATACCCCGGCTTCACCCGATCCAGGTACAGCCAAACTTGCGAGC
CCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACGCTTGTGCCCTTGCCACCTT
GTAGTGTCGCTGGATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGTGTCGCTTTTTTCCAGGGTCGACCGAGG
ATCCCAGCCATGCACTAAGAAGAACGGGGTTTCGTTCCTCGTCCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCGTATTCGTCCCAGTCC
CGTTGGTCGACGTCCGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATAAGCGAGCGTCG
CTCGCTGTCTCTGACCCATGAGTTTGCTGAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGCCTCGCTCGCGCCGAAGCG
CCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGTTGCATTCGCTTTGACCACGACAAACCCCGTGAAGAGGTCGACGCAGACT
AACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACGATGTTGCCCGGCGACT
CGCCCTGGATGGTCGGCCGATCCTTTCCGGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCCCTGGTCAATGGAAGTGGCG
CCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGCGTCTCCGGGATCACC
AGCTTCATCATCACATCCCGATCCTCGGCGGAATCGTCACTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTTTT
GGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCTGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTTCTGGGCGACGCGGAT
GCGGTCCAGGCGCAGTCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGCAGCTTCAGCCCCGGGGACTTGCAG
TCCATCTCGTCCCGCATCTGCCTGATGACCAGGTTGGAGTCTCCGCACACGACGAGTCGGGTGACGTCGTCGAGTTCCTCTAAAAGAGAACATCCGAGCA
GCAGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCATGATCTCCCAGTTCGGCAGCTGCCAAATGACGGCACT
GTATGCTCCGCCCTCTCACTTCGCCTTAGCCGATCCGTCGGAGCTCAAGACGTGCAAGACCTCGTCGCGCTCCACGTCGGGGACTGGAATGACTACAATC
CTGGACGCCCGTTTCCGGGGGGCGATCTCTTCTAGCGCTGCGTCGACGAAGGCTCGCGGTGTAATGCTCGCGTCCAGCGCGCCGAGGAGTTCTTCTTCTC
CCTTCATGGATCGGCAGACTTCCAGCTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCTTTGGACCGGAACAACCAGGCGAG
CGTCGTGGGACGTGTCAAGACGCGGACCGGTAGCATCGTGTAGCACTCGTTCAAGACGCGCAACAGGGCCAAGATCTCCTTTTCGACGATGTCGTAGTTC
AGCTCGTTGGGCTTCAGCGCACGGCTGGTGAACTTCACAGGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTGAGATGGCCCAGTCGCTGGCGT
ACACGATCACGACGGATTCTCGGTTCGCGTCGAAGGGCTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGTCGAAGGCGCGCGTCGCGTGCGT
CCACGTCTCATGTCCGTGGACTTCTGGACGCTTGGCGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGCATATACCGCAAAGTCTGCA
ATGAACCGGTGGTAGTAATTGAGGCTACCCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGCGACTCCAGATTCTTCGACT
TCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGATGGACAAGTGCCGCTGCTC
GCAGACATCCTGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAACGGAG
TGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCTGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAGAGCGCGTTGTCGATCAAGC
GTTGGTAAATCTGCGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGGTGAGCCGGGCCCGGTC
TGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACGGATACTTGTCCAAGTCTTCGAGCAAGTCGTGACGAGCGGCATGGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCTTTGAT
CAAGTCGGCGACCTTCTCTCGAAACAGCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGATGTCGCAGACAACACCCAGG
GCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCCCGTGGCTTCCTCGGGCG
GGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGATCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTAC
GAAGAGGCCGGACCCCTCGTGGATGAGGACCGCGTCTTCTTCCTCCTGCTCATCCGGTTTTGCCTCGTCGCGTTCCGGCTCGGCGGGTTCTGGTTCGTCG
AGTTTCGGCTCGGCGAGTTTTGACTCAGGCGATTCCTTCATCGCAGCGCTTCCAGCCACTGTCGGAGGCCCATCGGGTTCCACTTCCACCGCCTCCTCGC
CCGTTTTCCGCTTGTGGTCGTCGGGCGGCACCTCTACCCCGCTTCCCTTCGGCGCGCTCGCGACAGCCGCCAACACTGGGTCACGGCGCGTCGCGTCCCG
AGTTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATTCGTCATCGGCCCGTCGAGCTCGGCTAGGATCCAGTTCTCCTCCG
CGTCGCGCATCGCGCCGTACGCCAGATTTTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGA