Description :
From Genome Similarity Track
Location :
Scaffold_2571:175- 2893
Sequence
2718 bases(100 bases per row)
GGCGCAGTCCTATTCGTACGCGTATAGGTGCGTTCCCGACGTACTCGGCGTATGGCTCCCGAAGTCCGTTCGTACGGGGCCCCTCCGGCGTACGGTCTTG
ACCGCAGCTTTGCAGCTCCGCCCGAGGCTTGGATGCCTGCTCCGACGCCCTCATCGACACATGTGGCCGGCCCCCGCTACGAGAAGTTGGGCCAAGGTGA
GTCTGCGAGTAGCAAACCCAACCCCCTGCGGATCATAGTACCGCTTAAGACGTCCACGTAGAGTGTCGGGTGCGTCGTCATTGATTTAGGCATACCGGTG
GTGTACGACGCACCATGCCTGGCCAGGACTGCGTCCGGTCCAATGAAGTGGTGCTTCAGCTTGTTGCGGCCGACAGAGCTGACAGTGGCTAGCGTTAGAC
CCCTCGTGTCTAATAGCACTAAGCCCCCACCTTAAATGCACTTAAGTTATCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCTTGAGCTGCTGCC
ATGGCATTGCGGACCCTGCTGATCACGCTCAGCTTGGTATCCACAAATTATTCCACTTGTTTCCGCAACGAAACCGGTCTCACGTCGGAGACCTGGGAGG
AAAGATCTTTCCGAGCCTCTCCCCAACATAGAATAGAGGATGCAGTGTCTCCTCGAAGCGAGAGAGCACTCTGTGTGCGAAGCCATTCAGGTAGAATGGC
GTGAACCCCGTGGACGCGTCCATCGCGTTGTTGAGCGCAAACTCAACGACTGGAAGATGCGTCGATCACGTACGTGGTGCGTCCGCGCACACACTGCGCA
TAGAATCTTCGAGCACTCGATTGACGCGCTCTGTCTGACCGTCTGCCTGAGGATCATCCGCAGTGGACATCTGCAGACTCGTTTCTAGTAAAGGGGACAG
CCTTTTCCAGAACGTAGCCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCAACGATGAACAACCCCGCG
GTGTGTTCACCTGTGACGGTAACGGGTACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACAACAAAATCCCGGTGTTGCCGTGTCCGTCGG
CGGGGAACCGAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGAACGGGCAGGATCTGTAGTGGAGCCGAATCGTGCCCTGCGGGTTTGAC
CCGCTGACATGTTTCACATGTCTTCACGTATCGTGCGACTCACTTGTACATGTGGGTCCATCAGAAGACCTGAGAGACCGACAAGAAGGTCTTCACGCGA
CCCAACTGGCCGCTGGAGGGCGCGTCGTGCGCCTCCACGAGGAAGTCGAGCGTCCGATCCTCGTTGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCT
CCACCCGGTAATAGAGGAGGCCATCCTTCAACTCATATCGGTGGAGCCGGGAGCGCTGTCGCGACGAAAGCCAGTCGGACTTCGCGTTCGTTCCTGCTGT
GAGGAACTTAACGATAGGCGCGATAGCCTCATCTTCCCGATACGCCTTGCGTATCCGATCATGTAGATCAGTTGTCACCCGTGTGGTGTGGGCCAACTCG
TAGTCTGGACGCCGAGAGAGGGCGTCCGCAAGCACGCTGAGCTTGCCCGGCTTGTACTCAACGCGGAAGTTGTACTCCGCGAAAAGGGCAGCCACCTCGC
CATCCGTTGGGAGAGGTGAGGCAAATTTGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCGTGAGCCCAGAAAATGAAACCTGAAA
CTTCACAAAGGCGTACTTCATTCCCAGAAGTTATTTGTCGTGAACAGGGTAGTTCTGTTCGACGGCTTTGGGCTGCCTGGACTGGAATGAGATGGCTCGT
TCATGTCCAGCCGTGTCGGCCTGCAGCAGTGCACACCCGATGGCATAATCGTAGACATATATGGCTCGTTCATGCCAACCGTGTCGGCCTGCAGCAGTGC
ACACCCGATGGCATAATCGGAGACATCGCAGACGACGCTTATCGCCTTAGTCTCGTCTCGTCAGGCAGGGCCAGGACAGGGGCGTCTTGGAGAGTGGCCT
TGATGCTGTCAAAAGCATCATCGTGCTCTTGCTCCTAGCGCCAGTCGGCCCCCTTCTGAAGGAGGCCCGACAATGGCTTAGCAAAGCCCGCGTACTGTGC
GTTGTACGTTTAAAAGTAGTTGGCCAAGCCCTCCACTTTCGAAGATCCTTCTGGGATCAAGGCGTAGGCCATGCTACTATGGCCTTGACCTTGTCTGGGT
CAGCCCAAACGCCCACGCTGCTTACGAAGCAATCGATAACCTTAATATCTGGTTACGCGAAGACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCG
CATCACGTCCAGCACTCGACGGAGGTGCCCCAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACAACGATGTCGTTGAAGTACATC
TGTACGAAGGCGCGCATTGGGATAAACAATTGCGTCACCAGACGGTTGAATGTCGCCGGAGACAAGCCCAGCAGCATGACGAGCCACTCCCAAAGCATGC
CGCTTGGAGTGCTCACCGTGGTGAGCGGGATGTCGCTCTCGCGCATCAGGATCTCGTAGTATCCGTCTACCAAATCCAGCGCACTGTACATTCCGCTTCC
GGCCATGTTGCTCAACAA