Description :
From Genome Similarity Track
Location :
Scaffold_1671:175- 1698
Transcript NameFunction/comments
Phymu_g13533hypothetical protein PHYSODRAFT_261658

Sequence
1523 bases(100 bases per row)
TAgttggtgctgttgttgcgGATGTAGTACGGGTCGTTCATGAACTCCTCCTCACAGTACGGGAACTGCGTGTCATCGTCCGACGGCGCGAACAGGTGCT
CGCCGGCGTGGATCATCACGTAGAAGCCCGTGAAGGTGCACACGATAATCACAATGATCGACGCACCCTTGTCCAGGATCGACATGCTCTTCCAGGACAC
GCGCATGTAGATAATAAGCGGCATCAGCAGGCAGCTCGTCGTGTGGGCAGTAGCACCCGTGAAGTCCTGCAGGtcgatgaagcgcttgcgCAGCACCACG
GCGATGATCACGAGGATAGCAATGATCGCAATACGAAGAGCGATGTAGCGCAGCGGGTTGTTCTTGTACGGCGCgtgaagctcctcctccgtgatctCCT
CACCGAACTCCAGAGCAACGCGCAGGTGCGACATACGgccctccgtcttctccaccagacTCGAAGCAGACACCTGACGGTTCGCAGCGTCCAACGGCGT
GGAGCTCTGCATGTACGACTGCTTCTCCTGAAGCTCCATGTCATGGTCAACGTTGGCCTGGTCCATCTCGCCATTGAAGCGGACGATTTCGGGGCCCTTG
TGCATTCCCAAGATCAGACGCTCCGCCATGAAGAACGGAGGCATCATGAGcgtcgagaaggcgatcgaAATGTGCATCTGCATGAACAGGTACGCCATCA
CCACAGCACCACGGTCAGCGGAGAAGCCCAGAGGGGCCAGGCCCAGCGGGTCCGTCGTGCTCACGATCGAGTACAGGATGTTGCCCGAAATCTGGCAGCC
ACCGGCCGTGTAGCCGGCCAGAGCGATAGCAACGAAGAAGCCCGAGATGAACAGGATGGTGATCACCACGACGCGAGGCATGCGCTGCGGCTCCGAGTGC
TCACGCTGAAGGTCGGGCACCACAATGGCAGCGCCGTAGGCCAGAGCGAGGTTACCGAAGCACGTCAGCACCTGGTGAATGGTGATATCGGGCGACGGGA
TCGATCCGTGGCCACGCATGTTCCACTGCAGCAAAATCACGGCAATGATGTCGGCGATAATCGTGCCCATGCAACCGGCGAACGCCATGCCGGCGctctc
cttcagcgtcgggATCAAGCAAACCGGCACAACCATgagcgccatgaagatgatCCAGAAGGTCTGGCTGAACGAGTCCGggaacagcacgtccagcaga
gTGCTGCCCAGCACCAGGAAGGCGATCGGCACCAGCAGACACACGCCCATCTGAGAGACAaccgtgaagaagcggccCCACTTGCCCAGGGCCCACTCAC
CCAGGTCACCGTACGTCCTCACGGACGacggcgccaccagcatcaccttGGACAGCTTGAGCGTGGCGTAcgtgttggcgaagatcATGAAGGCAAGGGC
GATGGAGGCGTAGAACGGTCCGGCACGCGCGTAGTTGGAAGGCATGGCCAGTGAACCGATACCGCAGACACAGCAGAAGAGGTTAAAGGacgccttggcg
tcctccatggtgaagaaggcgga