Description :
From Genome Similarity Track
Location :
Scaffold_35:17499- 22452
Transcript NameFunction/comments
Phymu_g2073L-allo-threonine aldolase
Phymu_g2074L-allo-threonine aldolase
Phymu_g2075hypothetical protein

Sequence
4953 bases(100 bases per row)
GGCGCCCCGAGCTGTCGTGAACTTCCTGTCCGATACAGTCACGTGCCCTAGCGCCGCCATGCGCCAGGTGATCGCGACTGCGAAAGTGGGAGACGCCGTC
TTCGGCGCTGACCCGTCCGTGAATCTGctcgagaaggtggcggccGAACGTCTTGGCAAGGCCGCAGCGCTCTACGTGCCTTCGTACGGCCCGGTTTTTC
AGCAGTGCACAAGTGGTTTTTGGCTTTAACGTCGTGTATGTCTACGTAGTGGCACGATGTCGAACCTCATCGCTATCGGCACGCACTGCCGCCGAGGAGA
TGAAGTCATTTGCGGAGATAAATCCCACATTTTCGTCTACGAAGGTGGCGGTGCCAGCGGTGAGTAGATCCAGCAGATATTCGCCTGTAACTAGGAAGTT
GTACTGAGTTTTCTCTCTTTGTCTTGTGAAATCTGCAGCGTACATGGGGGTGAGTCTGCACACGGTGCCCAACCAGCCGGACGGAACACTCGACATCAAG
GACATCCACAACGCCATTCGCGACGATGACCCGCACTACCCACGCACGAGGCTcgtcgagatcgagaacaCGCAGAACTCGTGTGGTGGCCGGGTCTTAC
CGTTATCGTACATCCGCGAGGTCGAGCAGTTCTGCCACGAGCGCAACCTCcgcctccacgtcgacgGCGCTCGTCTGGCCAATGCCAGCGTGGCATCTGG
GATCCccatggacgagctggtgcgtGGTGCCGACTCTGTCTCGCTCTGTCTAAGCAAAGGTTTGGGGGCGCCGGTCGGCTCCATCCTCGCCGGACCAGAA
GAATTCATCCATCACGCTAAACGACTGCAAAAGTCTCTCGGTGGCGGCATGCGCCAAGCCGGTATCGTCGCCTCTGCAGGGCTGTACGCGCTCGAGAACC
AGTTCGACCGCCTCGTGGAAGACCACAAGAACGCGCAGGCGCTGGCGCAcggcatctccagcatcccAGACGTCGAGATCGACCCGGACACCGTCGACAC
caacatcgtcttcttcactctgACACCCGACGCCAAACTGGACGCTCCGACACttgtgcagaagctggaaacCGAAAAGGGCGTGCTGGTCGGAGCTTAC
GCCGATGGGAACCGCGTGCGTGTTGTGACCAACTTGCACGTATCCAGAGAGGACGTCAACTACGCCGTGTTGTCGATCCGTTCGCTGCTGAGCTGAGACC
GCAGCGACTAAACTGTGACGCAAAGTGACGGACTGGGGCCTTGGGACGTGATTGGATGTGGCCTGCCTCCCTGCGACGCGCCAAGTGCAGCGAGTGCTTC
AGTAAGTGTAAAAGTATCTCACTCGAGAGCCACAAGTGTTTCCTTTGAcccaagcagcaccacgtgAACGTTCTCCCTGTTCCGGCTATCGATCACGACG
TAGTCCACCACACGAACATTCTGTCTTGGCTTTTGTATGTCACCGAAATCGTCAGCCTTGCGTAAGCTTTCATAAAGGCAAGAGTAAGGATGGGCCAAAG
GCTGAATGTGTAAAAATGAGATGACAAAAAAACCAAAAGTGCCATCTCTCTTGCCGCCTGTATGCGAATTCACGAATTCAAACCTGTAAAGCCGCTTTTA
CCGGGGTTTTCGACTGTCTACGCTGTTTTCCGGCTGGTCTTTtgccgtgctggtgcttgttCGGCGTCATGTCGCTGCGACCAGCGCAACTCTGCATGCT
AATTCCGCCGCCAAATGTGCATAAATCCTCGTGCGCGAGCATTTGGCAGTCGTGGCGTGCAGCCACCCGTCCAAGCGCCAAGCGCCGGCATTTCAGTCGC
TCCATTTCCACATCAGCCGACTCCAGACCACACCAAAGACCATGACTGCTCCGCGCCGCGCAATTAACTTCATGTCCGACACCATCACGTGTCCGACGCC
AGGCATGCGCAAGGCCATGGCGGCCGCCAAGGTGGGCGACGACGTCTACGGCCTGGACCCCACggtcaagcagctccaaaAGGTGGTCGCCAGTATGCTC
GGCAAGGAGGACGCCATGTTCGTGCCCTCGTACGTAATGCTGCTTGGTTTCATTTCTGAAGTTTGTCCATCCCCAAAACTAACCGCCTCGTCTCTCATGA
CTCTTCAGGGGCACAATGTCTAACTTGATCGCCATCGGCACACACTGCCAGCGCGGTGACGAGGTCATTTGCGGCAACAAGTCGCACATCTTCACGTACG
AAGGCGCCGGCGCCAGTGGTGAGTCTCCATTTGCATTCGTTTTTTTAGCATTAAGACAAGGAATCTGACTggtatttttttgttttatttttcatGAACT
GCAGCGTACATGGGTGTCAGTCTAGCCACTCTGCCCAACCAGCCCGACGGTACGATCAAGCTCAGTGACATGGCTCGTGCTGTACGCGCCGACGACATCC
ACTACCCGCGGACTTCGCTAGTGGAGATCgaaaacacacacaacacTTGCGGTGGACGAGTGCTTCCCGTCTCGTACATCCgtgacgtggagaagttctG
CAAGGAGCACAATCTGAGTCTCCACGTGGATGGTGCACGTCTCGCGAATGCCAGTGTGGCCTCGGGTGTAGCTCTAGAAGACCTGGTGAAGGGCGCCGAC
ACGGTCTCCTTCTGCCTCAGCAAAGGACTGGGTGCCCCCATGGGCTCCATCCTCGCCGGTTCTGAGGAATTCATCCACCGCGCCAACCGGCTACGCAAAT
CGCTGGGTGGTGGCCTGCGCCAGTCGGGCATTGTAGCCGCCGGTGCTCTTTACGCACTGGAGCACCAGTTCGACCGCCTCGCGGAGGACCACGAGAATGC
GAAGACGCTTGCACACGGTCTCTCCACAATCCCAGGCATTGAGATCGACGTGGACAGTGTGGATACCAACATGCTGTTCTTCAAGGTGTCGTCGGACTTT
AAGATGGACACCCCTGCACTTGTGAAGAGagtggcggaggagaagggcaTTGTCTTCGGCGGATACTGGAGAGGTGAAGAGATTCGCGCAGTCACCAACT
TGCACGTAACTtccgacgacgtggagtaCACAATCGCCTCCGTACGCGATATTCTCGCTGCCAGCGAGTCCAATTGCCAGGTTGCGTAAGGAGTTGAAGG
GATATGCCTGCTGGAAAGCAGAGCATAAAGCCCTCCTCGATTATTTTCAATAAAAAAGTGTTCATAGTGGAGTTTTACAACAAATTCGAAGGTATGCTCC
GTTGAAATTCGTTGGTTTTCAAAATGAATCCGTGGCGCTGCGTACTACGTGCCGGTTACTACACTTTGCATCCTTCTCATCATCTCCCAACGTTGCCACT
ACGCAATAGGCCAATAGCGCAAATATTGCTCACTACACTACTCGCTTTCATGCTCATCTTCACCAGAGCTTTCTCCGTACTCACCGCGACAGAGGAAGGA
CTGCAGAGCCCACTCTGGAGTTTCAATCCACGGCAGTTCCTCCTTAAACTCTTCGTCGGTCAAGCGTTGGCCTAGAGGCGTTGTGAACTCGTAGCTGCTG
AAAAGCGGACCGGCATACATCACCTTGTTCACGATAAAGAACCCTATGACCGGGTCGCCGACACCCAGATGCAGCACACGTCCACGGTCAGCATAATCAG
TGTGGACATCCACCGCCAACACGTCACTCGCGCACGACTTCGCCCTGGAGCCGTAAAATAGACTCGGGTACCATCCTGTGTACGTCGGAGCCCCACTTCC
AAGTTCTCTCTCGATTATCGACTGCATAAACGTCACTTGCTCTTCGTTTAGTTCCATTCCAGACGTTTGTAGTACAGCGATCTCTTCTAGCGTCTCCATC
GTTGACGCGAACACATGAAAGTTCGATCTGCTGCGAAAATCGCGTAAATTCTGTGCGTCTTTCTCGATATCGTTCATTCTTAGCGCCATCTCGCGCATTC
GTCGCCAAAACTCCGGATACGGGTCAACCATACCGTCCGGAAACTCACACATTGGTCGCATTCCACCACTCTGCTTTGCGTACAACACAGTGTCGTGCCG
TAGCTGCGTGAACGAAGCGATTTGTGTGTTCATTTGACGACGCTGCCAAGTCCCGGTGTGAAACGTGCTCGATCTGTTTGGGGATGGCGAGGAAAGAGCT
CGGAGAGCCGAAAGCCACAATGTGCTTACGCTGGCAGTCGTCGCAGTAGACTCCTTAGCGAATTCTTCATCCATAATCTTCCGTAGCGCCACAAGATTCG
AGGAAAAGGGAATTCCGTCGCGATGGAGCACGAACTCGTCCGCATCTGGAGACATTTTCATACGAGCGACAAGCTCTTGGGCTGCTTCGTTGTTCCCGAA
CAGGGTAAAAGCAACATCCACCACACTAGGAATGTATCGCGGTTGCTTCACTCCGTCGTGCACAACTTGGCCGTCAACTAGTCGGGAAAAAACGAACGCG
CTCCAGACAAAACGCTGACCAAGCAACGCCAATCAGACCAAACTTTGGTCTCCTTGCTCTTCGGTCATCGAATCAAAAGCACTAGGGATCTgtgaggctg
aagagcttTCAacaatctgctgctgaagttccagcagcaaatcCTGTCTTTCTTGATCGCCAAAAGCGCTCGGGTTGGTCAACGTAGCCATACTCTCCGG
TGAAATAAACTGCGTAAACTTTTTCATCGACAGTGAATCAGCCCCAGAACCAGCCAGAGACGACAACAGCGAGTCAaactgctggacgtcgtCTAACGTC
TCAGATTCCCGAAGACAGCGCAGCAAGATCACACCACAGAGCAATTGATGGAGGTCGCCCATACAAAAGTCCACTATCCCGAGCCACATCATGGCTCGAA
AGTAATTCTCGAGTGACTTCGACTTGATGTAGTGTCCGCGGGGTTTAAACAGCGAGAAATCAACAATGCGTGGAGTCGAAAACAACTCCACATTCGCCAA
TCGCTCGTTTAAAACTATGGATCTCTCAGCTTCCAGGTTTTCATACCCGTCCT