Description :
From Genome Similarity Track
Location :
scaffold_209:17485- 19025
Transcript NameFunction/comments
Pl_107670hypothetical protein PHYSODRAFT_474806

Sequence
1540 bases(100 bases per row)
AGAGAGACCAAATTCAATTTATAGAGCACCAATATATAATATCGCACGTCTTGCTTACCTTTACGATTTCCGTTAGGTTTGGCGTATATCTTCCCTGACC
TCACACTTCCAAAGCTTTATGAAACGTCCGCAGTGAAAGCACACAACGCTAGATCTGCAACCGGACCAGGTCTTTAAATGTCGCAATGCCTGGGTTTTCC
ACTCCTTTGGAGTCAAAAGCCCGACAATCGCCAGTTACTTGTGGGTTCCCTTCTGTCGCTTCCAATTTCAATACGTGCTCCAACTTGCCAACGTTGCTAT
GACTGCAGCGCTTCAACGCACAGAGAAACCGTTTCGATGAGTCTACAGACGATGTTGACACTGCGTGAATTCGGGTCTGTACGACGATGGGGAGGAAGTT
CGTGGTATCCAGCTGGTTAGATTTCAAGCGGGTTAGGTGTGACTTACAAACACCAAGTCAAAGTGCTGACTCTCACAGACCATTGGAAAAGCAGGAGTCT
AGAGACACTAACCGCATCATGTGATCTGATGGAAGCCACACCTGCAGTTGGGGAATTGCTCAGAAACCGCGACCAGGCGCTTCGCAGCAGCACAAGCGCT
TTGTCCGATTACGTAGCGCAGTCGCCCCGTCGTCCCGAGTCTCTTAACGCTGCGGCTCCGCTTCTACATCCGTCGCCAGACTTTCCCTCACGGCAGCACG
GGATCCAGTAGCAGTCACTAACTCTCTCCATCACCAGAGCAACAGGACCACCAGTCGACTGTCGGATCGTTCCCCGCCTCACAGACACAGGTGACGACTA
TGGTGAATCTCTCGATGGACAGCAACGTGCTGGACTCGCCGGCCGACTCGCTCGACCTGCGCCAGCCGCCCTCAGGCTACAGCCACAATGGAGACAGCAA
CCGCGGCGAGAGCAAGTTCTTCGCACTCAGCATGAGCGGCACCAACATGGCTGGCAAGCCCTCACAGCTCGCTACGCCTTTTGTGTACGGTACACCCGTG
GACAAGAATTACAAGACGTGGCCATTCCTGACGGTCGGACTTTGTGCCGCTATCGTTATCTTCGCTATCATCTACCACGAGTTGCCGGAATATCGACTAG
GCTTCCGATACCAGCTCTACGTGCTTTTTGGATCGACGGTCGAGAATGCCCAGTGGGTTGGAGGACACCGTGAAGTTGTCGAGTTCATCGTCAACTACAT
GCTGATCGGAATGCCGTTCATGATTGGTGGTATGGCGCTTGCACTGGGAGACGCATTGCCGCCTGTGCCAACGGGAGCACACCGCACGGTCATGAGATTC
CTCAAACGCAAGATTTTCGTAGGCGCCATCAACATCTCGTATGCAGAGTCCGTCTGCACACTCGCTTTCCTAGGACTGAACGCTATTTGGTTTTCGGCCG
TGTTCTCACGTAACTACGATGACCTCGTGGAGGCCGACTCCACCGATTCTGCGTCCGTGTTCAGGCTTGTGGGTAAGGTGTTTGGATTCAACGCGGTGCT
GTGCTTCTCGTTGCTGATTATTCCTGCCACACGTAACTCA