Description :
From Genome Similarity Track
Location :
contig_9:174833- 179928
Transcript NameFunction/comments
g2237.t1conserved hypothetical protein
g2238.t1hypothetical protein

Sequence
5095 bases(100 bases per row)
TACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGT
TCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGA
GCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAA
AGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGA
CCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGC
CCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGCTGCTGGTTCCCAGCAGCGTCGTGGAT
CAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGG
GTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGA
AGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCT
TCGTGCTCTAGTGGACTGTGGGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGG
AAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGT
CCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTC
GGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGG
CTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGG
GTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGAC
GCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACG
AAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGA
AGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCT
GCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATC
CTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCT
CTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTC
GACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGC
AGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGA
CGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGG
CGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTA
CTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCT
CTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCG
AGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGC
GAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGA
CCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTG
AGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCA
AGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTG
ATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCC
TTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAA
GTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCC
GACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACG
AAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCT
TCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAG
CTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGA
GTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACC
GACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGC
TTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGC
CACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGA
TCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTG
CCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTAC
TCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGAC
TCGCGCACGTACTGCGCGCAGTCATGGCGACAACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCT
GCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAA
TAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCA
GAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTAC
ACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGA