Description :
From Genome Similarity Track
Location :
Scaffold_380:17481- 23354
Transcript NameFunction/comments
Phymu_g9291hypothetical protein PHYSODRAFT_552991
Phymu_g9292conserved hypothetical protein

Sequence
5873 bases(100 bases per row)
AAGAGATGCCGGCCGACATTGAGCGCATCGTAGACCGCAAGTTGATCAAGCAGCGCGTGCACTACTTTGTGGTCTGGAAGGGCTTCGGAGAGGAGAACAA
CACCTGGTACTAGCTGCCTCCAGTCCTACGCAAACATGTCCATCACTTAAAAAACCTATTTTCTGTTATTTTAATTCCAAACTTTTGCTATACAGGGAGA
GTCGTATCGACTTAAAGGCTGATGGTTACTCGGATGTCATCAAGCGTTTCGAAGAGGGTACGGCTTCAGCTCCTAGCGTTCAACTGTATCATAAGTATTT
ACTTATCGTTTTATTTATTTATCCGTTGCAGAACGCAAAAAGGAGTCGGGAGGATCGACACCCCGCGGTCGCAACCCTAGCCGCTCGAGATCCAAGAGCC
CGCGCAGAAGTAAGAGCCCTGGTCGTGCCAGAGGGCGTCGCAGTCGCTCTCGCAGCGCCTCAGTGAGTCGCAAGCTGCCCGTGGACAAcaatgaagagga
ggacaagaaggacagtCCTGTCAAGACGTCAACTCCCAGGCGACGCAAGAGTCCCAGAAACAATGACGAGAACAACGGAAAGGAGACGCCTAGACGCCGA
TCTACCCGGAAGCTTGCCacaacgtcttcgtcgcagTTTGTGTCTCGCttggacgagcagaagatggaCCCTGTtacggatgaagaagatgactCGCTGT
TTCTCCGGTCGACGATTGCTGGGTTGGGTCCGCGGGTGCAGGAGATGGCTCCATCTGCCCCTTTGGAGGCTGAGACGGTTGTGCACAAGAAACCAGTGAC
GTTGTCGTACGAGGAAGAAGGGGAATCAATGCTACTGAAGCCGCAGAGCACGAAGGAGGCTGCCACCGACTCAAGCTCTACTGTTGATCCCGTCCACAAT
CACGATAACCCCGCGCAGGGCGGTTTGATTGCCAAGGTATTGGAGAACGACTACATTGGATCGTTGCTCAGTGTAGCAGTCGTTGTTGGCTCTCTTATGG
CTAGCCAGATGCTGCCGAGTGCTGAGGAAGAACCTGAATTATGGCGGAGGTGGCTGTCGTTCCTCATCCctgtggtggcgctgctaACTTTCTTCCACCA
GAAGGATGCTCGCGCTTCGGCAAAGTGGGTGGCTACTGGCCTGGcttggcgtgctgctgcagagctgctgctgttgatcgGCGCCACCCCGCGTGAGTTC
GAGACGATGGTTGCTGGCTCGGCCCTTCTGGCTAATGTGTCGTTGCTGGTTGCCATTGTGGTGATCCTTCGCAACGGCGAACACGAGCAGTCGAAGGCTA
CACtagtgctgctggctgtgggcTCTCTGGCCCTGTTCCTTTCAGACAGGTATGTTTTTCATTGAAAtatgtgtgtgtgtgtgtcaATGCTTAACGTGTT
TTGCTCACCAGCTGGGTGATTTCTACTGAAAACTCCGAGTTAGAGTCGCGTGTTATCCTCATGTCGATGGCCGTTGTAAGTACTATTCCCGCCTCACGTT
TGTTCTTAAATTTTATGACTGACGCTGTGCGTCTCCAATTGAATTTCCAGCTGACAATCGCACTGTCACCCAAGCCGACGATCTCCTTGGACGATGACGA
ATAGGATAGAGCGCCTCAGCTACCTCGACGCTGTAATTAGGAGCTTGTTTTTTCGCTGACTTCATTCTGAGGcaccgttgttgctgctatATGAATTTTA
TGATCTCCGTTGTTGCAGGCTGGCTGCGTTAGACTGCTCCATTAAAGCTTGCCGAAAGATTCTGTTTTGTATTTTCAACAGACCGCAAGTACATTACTCT
AGCGATAGTGCGAGATGCAACGTCTTGATCAAAAGCTGTTGGCTCTGGACGCTGACGACCGAATCGACATCGCCCTCGCGATGCACCAGCTCTCGAATAA
CCTCAATCGTCAGTGCAGCCGTGGTTCGAGCTCCGTGCACCCTGTGTTCGGGTTCTGCCGAATACTCCTTCATAACCTTGTACAGTAGCGTCTGACGCAT
CAGTGACTCCAACTTTTCCTCGTTCACACCAGCACCTGACTCAACGGCCAAGTTGTCCCAAAGTTCACCGTCATCAACGATGCAAGATCGCCATACATCA
GCGCGCATCTCCTCGTACTCCTCGGTCAGCGGGTCAGTAGCTAGAGTCTCTAACACTTCGAGGGCCATCAAGAAAATATTGGTTCTGCAGTAGTACGCAA
ACGCATTAGTAAATAAAAGTTCAGAAACAAAATAAATACCAGTAGCAGCACTCAATACCTCATGGGGTCATCCTTATCGGCAGAAAGAGCGGAGGACAAG
CAGGCCTGAACCAAGTCTTCTGGGGAAAGAGGCTGCGGGTTGATAGGGTCCTTCAACGGtaactggagcaacagctCTTGAATCTTGCCACGGACAAGCT
ACAAGGTACAAGCACAAACACATGATTTAGTATCTATTTCCCATTGCGATTCATCAACCAATAGCAAAACGTACCTCATGGTTGATTTCTTGAACCCTGT
CGGGGTGAGATAGACTGGGGGATGCAAAGGCTGCGATCTTGGCAATACTAGCCATCGTCTTGCGCTTTGGCAATGAATGCTGCTCGCCCTTGGCTTCACG
CAGAGCAAGTGTTGCCACCTGGTCATAACGCTCGATAGACACGGCTGTCAACCAGCGGTACTTCCTCAAGTGGTCACGGCTCTTCATGAACTTGTGCAGT
GACGGCGCAAAAATCTGCGAGTGAGCCAACAGATATGCAGTCATGGCCGCatttgcttcttgctggccttGTGTCCACGGGTTCCGAACTTCACCGTTAT
ACCAGCGGAAAATGAAGTTATCAAAACccttgtgcttcttgcagtaTGACTCCAGTCTCTTCGACGCAAGGCTCTTAGGGAGTTTGCCAAGCACACAATC
CAGCTTCGACAAATTCACCGAGTCTTCTACGAACACCAAGAAAACCATGCCCTCGAAGTACGCGTACTTCTCGCAGAGCTCTACGCACTGACTAAAGAGG
TCCGCTCGCTTCCTCGTCACGATGCCGTCTTGATCAAATTCAACGGCAATGTCGCTTTCTTGAGGTGTCTGAGTCGCAATGTAAACAAGGGGGTTCAGCG
TCACGCGCTTCGTAAACGTTTCCTCCTTACGCAACTCCTCTGCCTCCTCATCTGATGCGAGAGGGATAAACTGAGCGTAGTTGTCAAGCAAGACCGTCCC
TAGTCTTTTAATCTGATCCGTGAGCTCAAAAATCTCAGCGTATTGCCAGCGAATCTGCTTGTCGGTCGTTCCCTGCGTGTATCCAGTTAAAACAGACAAC
CGCGAGATTTGGTTCGCCAGAACTTCACGCACTTCGCGTGAAAACGCCCAGCTTCCGGTCGGTGCGAAGCTAGCAGCAGAGCTCTGCACAGGCGTGCACA
GCATACTAAGCATGGCACTGCCACTTTCCAGTAGAGCGTAAAGGTATGTCGGGTCGCTGTCGCCAATTGAAGTTGCCAGGATCTGCACTTCATCCCCCAa
aagctggaagagctcggcAATCTTGCTCACTTCGCAGTAAAAAACATCAAAGGAGTTGTAACCTGCCAGCCGAAGTTGCTCCTTCTGATAACCACGCTTT
TCCACGGTCTTCTCGATAGCGTGGAGGAGAAATTTCCCGGTCAACCGGCGTTGAATGTTTTGCACATCCGCTGACGTGTCTTCGTCAGAAGGAGTCGAAG
ACAGAATCGAGGCTTGAAATTTGCTCAGAGCAATTGcggcgtgcagcttctcttcGTTCTCTGTTAAATGGCGCTTCAACTCATCCGAGTTTTCAATAAG
CTTCCAGACGGACGTACAGCGGCGCTGAAGGAACTCCATAAAGGCCACGTGACGATTCAttttctcctccatctgATAACGCACCAGTTTGGGGGTGACG
GAAGAAATATCAGCTTCACTCGTCTGTGCATCTGTCTGTTTTGAGGCTCTGTCACTTCCTTCTTTCTCCCAACGAAGCCCCGATGACGACTTGGCATCCA
AAATCTGGAAATCCACAGACACGGCCGCCTGTGCGACAGCCCCCACATCCCTCGCGCTCACACGCAGCGCTGAGGCGGAGTTTGGATCATCTTGAAAGTG
TTTCATAATCAAGCGAACGTAGTCCTCCACGCTCAAGTTCTCGCCCAAAAAGTGTGAAGACTCGCTTGTGTAGTAGTTTGTTTCTTCATGTTTTCGGCGG
GTCCTCTCCACGGATGCCTCGGACGGAATTGGAGCCGCCAAACGCTCCAGTTTCTGCATATCGGACGCTGTGGCCACACACACCGACCCGCTCTGCGACT
TTACGTCATCGTTCATGAGCAAAAACGACACCGACCCCTTTACAGCGTTGTTATCAAAGGAGCTCTGGTCTACGCGAGCACCAAACGCCAAGGCCAGTCG
GCCTTGAGCACCTTGAAGCGGAAACACAGCCGAGCGAACACTAGTCTGGCCAACTTGTGGCAGAAGAATAGTAGAAAATTGGATCGGCTGCATGTGCGTC
CACACCAGATACAAGGCGCCGCGggtgatggagaagctttCAACCTGGAAGAACCGACTGGCAGCCTGTTCGTCAAACGATGGCTCAAAATCCAACACAC
ACGCCCACTCCAGCTCTggtgcagcgtcgtcatccaccGATCCGAGGGAGAACTGAAACAGCGCATACTTGACCTTAGCATTGGTGCCAGCACGCGACGA
AGAACAGACAAATGCAACCAACAGGGCGTAGCACGTTTCCTGGACGTACGGCATGGAAACAACGTACACTTTCGCCAGATGAGTGTCCGGAAAATTGTCA
CTGAAGTAGCTGATTGCCACGCGGCTGGCATCAAAATGCCATTGAGAAATGCACGAGCAGTCCATGACATCTCCAGTGCTAAAAGTGCGTCGCTCCATCA
TGCCATCCTggaacagcaccagcatATCCGAAGTCTCATCCACTCCCcctccactgctgctcaTGGAGACTGCATCTCCTATTGACGAAGGGAGCACTCG
CAAGTACTTGATGGGCTGGTTCACATCCAgttctcctccatctgctccCGATTTCGACGCcgtcgacgagaagaaaaactgTGATACGGACTTGGTAATT
CCAGATAGAAACCCCGCACTCTGCTTCTCAAAGGCTCGAACTCGAATGCGACGGTCCTCGACCGCTACTTCCCACACGTTGCCTTGGTTACTCCAGCATA
CCAGTCCAGTGGCATCTTCGTGAATAtcttcatcttgagctccttgagtCGCCAGCATTGCAGCATTAGGGTGAGTACTAACTTCTTCATTAACCCCAAG
GGGGATCTGTACACTAAGCGGCACACTCTCGTACGGGAGCTCAATATCCTCCCAAAAGAGCACAATGCCGCTCTTGCCCACCACCATGAGACTCAAACTC
TGGCTGTAAAGAGCAAAGAGGAATGGGAACAGAACCTCCTCAGGCTCGAGCTCGTCTGGCAATTGCAGGGACACCACTCTACCCCTGTCTTGTTGCCACA
GCATGATTTTCGTCCGCAATGGGAAGACGTAGTACGGGATCCATTGACGGCCGCTGCGATGACGCGCCGAAGGCACCGACGCCCGACAGCAGCGGATCTG
ATGACGCTGGTGACGTGGCAGCTGCGGCCACTCCTTGCGcagttcttccagcacttgggGCGGCAGACTGGCGCCTTCCACGatcgtgcagctcctcgtg
tccaccagcaacgacgcGTGTTCCTCAGGGTCGACCTCGCTACCCGAGCGTGGCGCGTACAGAGCATCCCAGTGCTCCAGCCGTTggcgcttcaacgtgt
cCGTGGCCAGCAGCCCCGAGCCCACGCGCTTGGCCGGCACGTCCACGAACTTACGGGCACGGAACATGGTAAT