Description :
From Genome Similarity Track
Location :
Scaffold_592:17475- 20734
Transcript NameFunction/comments
Phyta_totarag9505hypothetical protein

Sequence
3259 bases(100 bases per row)
TCCCAACCATGAACTAAATAGAACGGGGTGTCCAAATGTGTCGCGTCAAAAGAGGTATTCAGGGCGAACATCAGCCTTTAGGCATGATCGTCCCAATCCG
TCTGgtcagcttcagcgacaTACGCCTTGAAACTTCGCATCACGGTCTGGACCGACCGTTCTTTCTGTCCATTCGCCTGAGGGCGGTACGCCAGAGTAGC
CCGCTGCTTACTGCCCAACAACTCCCTAAATCGCTTGAAAACTTCACTCATGAACCTCGGATCTTGGGCATGCCTGATCATGGAAGACGCCCCGAATCTC
CGAAACACACATTCTTCGTACGCTTCAGCTACATCCTGAGCAGTTGTGAAGGTCATCGTGTTGCTCATGACAAAACCAGAAAAGGCATCCTGAAGCAGGA
GTAAAAAAGGGTTCCCTCGGGCTGACTTCGGCATGTGTGTTACAAAATCCATGGAGACACCTCGAATGGACATCTCGGCTCAATATTGTCTGGTGACGGT
CCTGAGTTCGGGAGCCGCCCCTTGCCGCTGGCACAATCCACACATTTCCTTCACAAAACGCTCCACATCTGCATACATACCAGACCAGTAGAACCCCGAC
CGCAACTTCTCGTGAGTTCTGGTGACACCTTGATGTCCACCCTGATAACCCTCATGTGCATAATGCAACATGTCTTCCCGGAGGGCTTTTAGGACTACCA
ACCTTGGCTCGTCCACAGCGTCGCGTGGACGATCCCGAGTAGAGCGCGCAAGTCGATACAGTACACTTCGAGCATCCAGGGCGAACAAGTCGGCAACCTT
TgcgatcttcttcagacgCCTCGGCGAAAAGCGATCCACATCACCATTCCGAAAAGCCTTAACCTCTGATAAGTATTCATCGCTATCTTGGTGTGCCTTG
ATACGTCGCCATCGCTCAGCCTGATACTCCAACGGACCCATCGACGGACCCTCATCTGGGGCACCTCAAGCGCCAGCTCGAGTCAAAACTGCCATTACTT
GTGCGGCcggtggaagtggcgcaGATTTGAGGCCCGGCATTGCATGCTCGGGATTATCTTTGGGGATGTCGCTCGAATCACTTCGTTATCGTTTGTGCTT
CTCATCCTGAATCACCGCCGGGGACTTCACCAACTGCTCACGAATTTTCGAAACCAACTCCAGGTGCTTGCGCTCGGACTCGTCTTGGACAACCCAAGAT
TCACCTAGTGCTAACGTCTTTGAGGTCAGGTAATCAGCGGTCTGGTTATAGTCACGCTTGACATGTACTAGCCTGAGCGTCCTGAATTTATCTTTCAGCA
CCTCACATTCCGCCAGTCTTCGTTGGAGATTAGGCTGGTTACAATTAATCAGCCGTTGAACCTGTTGGATGACGATCCTTGAGTCGCCGACCGCCACCAG
GTCCGGAATATCTCGTTCTAGAGCTATAGCAAATCCTTTCAGCAGACCGTAGTACTCGGCGTCATTTACAGTGACTCCATCCAGGGTGTATCCGCGTGCG
TCCATTACCGTCCACTCGGGTAGCCGCCACAGTATGCAACCACAGCTGCCCTTCCTAGTGGAGGCTTTAGCGGCTCCATCGAAACACAAGACGACTCCAG
TGTATCCGCTTCTAGCATATCGATACTCACGACTGGTGGAGCTTTTACACGCCCCTTAGCCGGGATTAAAGACTCAGCGATTCCATCCAAGTGTTCTCGA
GGTGTAATCCCCGCACCTAGAATCGTCGCAAGTCCGTCTTCATCACGCTGGACCTTTCGGATCTCCAAATCATAATGTGACAGGGCGACGCCCCAAGGCA
TTGTCCATCCGTCCGCAGTTTTCGATTTGATTACCCACTTCAGGACGGAGTACCGGGTGTACACGATCAACGGACATCCTTCGACGAGTGTCTTGAAAAC
TTGGAGCACTCGGATTACCGCAATGACTTCCTTTTCCGCAATGTGGTACCGGAGTTCTGCATCATTCAGGACATGCCCCGTGAAACGTACAGGCTGAATG
AGACCATCATGTTCTTGGCCGAGAACAGCGCAAGCCGCCCACTGATTGTCATGTGGAATGATCACAAATGGTTTAGTCCGATCGGGATGCCGAAGCATGG
CGGTTGACACAATCTTTCGTTTCAGAATGTCGAAAGCATATTTTGCCCGAGACAAGTCTCTCCCAGCCCGAACCTGATCATCTGTCAGCTCGTACAAGAC
CACAGCAACCACAGGAAAATCTTCAATGAGCTTGTGGTAATAATTGATACTACCCAAGAACGGTTGGACTCCCTTCAGGGTGGTCGGGAAAGGCAGATCT
TGAATCCCCTTGGCGATCTTCGGAGTAGCTCGTATTCCCTCAGCACCGATCTCGTGGGACAGGTACGGGATAGTTCGCTTTCCGAATTCGCTCTTGGGTA
GACTCACCGAGATGTTCCAATAACACAACCGGTAGAGTAACGCATCCAAATCATCGCAAAGCTGATCTCAGGTCGCGCTCCCGTGAGCGATGTCATCGAT
ATAAGAACTGCTCCCCAGGACTGGACCCATCTGAGGCGGTGCCGCGATACTTCGTTTAAACACCGTCATCTGCTCCGTCAGCGCCGTCAAATGCCGTCCT
GTGTGAGTCCGCTTCGAATCATCTTCAGTAAGGCTCAATTCAGAACCTCTCGGCTTGTAAGGATCCAACTTCAAGTAACCTAAGACGTCTTGGTCCACAa
gggcttcttcttcgggtgCCAGTCGGACAAATCCCCACAAACAGTTGTTAATCATGTGCTGGTAAATCAGTGGTGCATTTTTCAGCCCAAATGGCATACG
CACCCACTGGAAATGTCCGAATGGAAATGTCCGAATGGACAAATGATGGCCGAGATCCACTTGGCCCGCTCGGTCATACGGATTGCCCAGAAACCGCTTG
CCATGCCCAAGCTCATAAACCACATCGCACCTTCAAATCCAATCAACAAGTGGTCGATTAGAGGAAGTGGGTAGTTGGAAAGCTGAATGAAGCCATTCAC
GACTCGGTAATCAATACACATCCTGATATCGAcaccgttcttcttgagaaCAATCACAATCGGCGAGGCCCATGGTGACTCGGAATGCTCTATCAATCCA
GTCtccaacagcttcttcagcggctCATACACCTTAATCGCGAGGTATGGAGCGATCGACCGGGGACGTTGAGCGACTGGTTTAGCGTCACCAACATCTA
GGTCACAAACCACACCtcgtgcaggtgctgaagcagcatttccaTCACCCAAGAAGATA