Description :
From Genome Similarity Track
Location :
scaffold_4:174732- 175773
Transcript NameFunction/comments
g301.t1 papain-like cysteine protease C1

Sequence
1041 bases(100 bases per row)
GCACTACTGCACCTTACTGACGCTGAGCAGGAGGGATGTCACTGCAAAAGGACCATGAAAGGCCGAGAGCATCTGCATCCGAAGCTGCACCCGCTGCCAA
CCTTGACGCTGGACGAAGCTCAAGAGCTCGAGGAGCTCCCCAAACACTTGGACTGGTGTGAGCGCGGCTTCTGCGTCCCCAGTTGGAACCAGCACATTCC
GCAGTATTGCGGCTCGTGCTTTGCTCACGGTGCTATGTCGAGCGCCCAGGACCGCATCAAGATCCTCAACAAGCGACGCAAATACACTGGAGCAGACGTG
ATGCTCGGTCGTCAGAGCTTCCTCAATTGCGCACCTGGTCATGGACTCTCTGCTGGTTGTGATGGTGGCGAAGCTGTGGACGTCTACGAGTTCATGAAAC
GCTATGGACTGCCGGACGAGTCTTGCCTGCCGTACAACGCTACGGACCACACCAAGTTCCAGGAGACCAACGGTACTTGCCCACCACACGGATACTGCAT
GAAGTACGTCGACTTTCTTGAAGTTATTTTAAGTATTTACATGCTAACTTGCCTTGTCTCCTTCTGTAGCTGCATGTACACTCCCCAGAGCAAGACGGTG
CCGCAATGCTTCCCTGTTACGAAACTGGTGCGTTATCGTGCTAAAAGCCACGGCCACTTGTCCGGTGAGCTGGCCATGATGAAGGAGATCATCAAAGGTG
GCCCCATCACGTGCGGCATTGCCTGCAGTGAAGAGTTCACCTACGAGTACAAGGCCGGAATCCTGGAGGACAAGACAGGCTTCATGGACATTGACCACGA
CGTGGAAATTGTCGGTTGGGGTGAAGAAAATGGCGTCAAGTACTGGCATATCCGCAACTCGTGGGGCACGTACTGGGGCATGAATGGGTTCTTCAAGATC
GTTCGTGGCAAGAACAACCTCGGCATCGAGGCAGATTGTGCCTTTATGGAGCCAGACATCAGTGACGAAGAGCTCGTGTGGGAGGAAAAGTCGGTTTACG
GGGGATCCATCTTCGGCATCGTGCCGTTCAAGGAGGAAGCG