Description :
From Genome Similarity Track
Location :
Scaffold_143:17473- 19778
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_143-abinit-gene-0.33Exonuclease 1

Sequence
2305 bases(100 bases per row)
GCTCACTGTCGAACTTGTCGAAGGCGTGAAGTTTCGGTTCTACGATGAAACGCACCACGAGATTACCAGCTCCGACACATTTGGGAGTCTCTTTCGTGAT
GCTGAAGGCAAACAATCGACAGCACAAGAGTCCAGTCAGCCAAACATTCAACCGAACTCTGTCTCTGGGTCAACTTCGCGTCAGCAAGAGGCACGTGATG
CAGTTGAAGATGGGTCGATTACAAGCGAGCAAGTGGCTGATTTCGTGGGATTGTTTGCTGCAGACGCTGGAGAGGCCACCGTCGGGTCAGCACATCCATG
CAGACTGCTTGATGTTATTCAAGCGTATCTCAACCAAAGCGGCGATTGGTCGCAGATCAAGTTTGGGAAGGATGACAAAACCCCTCAGGCCGTCTGCCTG
TGGTTGGAACGGATCGTAACCGGAAAACTCCACCCCTCAGAAGAAGCAAAGTCACCATCGCGAAGCTTGATCAAGATGGATTTTGCATGTCGAACGGGCA
ATGACGCCGGCGTACGTTCCCTGTCGCTGCGAACGCGTCTGTTTGTGTTGGAGTTGCAACATGACGAGCTGTTGGGTCAGCACCAAGGCGGAAAGAAGAG
GACACATCGTGGTCATCACTTCACACGTTCATTGAATGTTCTCATCACCAAGGCAGAGAATCTTCTGGCGGATTTCTGCTGGTCAGACGATTCGGAGGAG
AGAGCTGCTGACGACGACAATGGCAACCAGCTCACCAACGTTGATTTCGCACGTCTCTTTTGGCTGCTTGCGCGCCTGTACGAGCGCAGTAACGACATGC
GTGCAGCGCAGATGTACTTTTCACAGTGTCGCGATCGACTGCTGTTACCTGCTCTGCAATCAATCTCGAATCGCAGTTTGCCGAGCCTTGACGTGGTGGT
GTTGCCGAACCAAAATCTCGACCAACAGATCTCAGTTCATATCCTCGACGAGAAGTTATCGGAGCTGCAGTCCTCGGACGTGTACGTCGAAACGCAGCAA
CTATACGAGCAGGGGAACCACTACCAGGTCGTATCGGTGCTGTTTGGATTCTTGTTCCCAACGAAACAGCCGCCGCGCCTGATGGAGCTGCTCGATGAGT
TCAGGACGCCAGATGCTACTGGTTCGTCGTCAGATACCGAGTCAACGCGGAAGATACTGCCTATTATTCTCGATTCGATCAAGCAATCCGACCTATTGTC
AGACGATGACGCGATTCTGTTTCTCCTGACCATGTTTCACCACGTTGCGGCTTTCATGGATGAGCTCCCTGTCCATGACGGCGTTGAGGATGAGTGTGAC
AGCCGAATTGACGAGGATCGCGAAATTGCACTGGAGGCTATTGAGTTTCTGTTGAGGCAGCTGGAGGAACATTTCTCGAGCTCGTTGCCCGCTAGTCCCC
ACCGTCTGTTGGTTCGCGCATCCTGTCTACACTGCCTGAAGCCTGACACGTTGCTGTTGTTCAAGTCTCCTGCCGAGATATTTGGTTTGCTAAGGACGCT
GCTGCAGAATGTCGATCCTCCTTCAGACGATAGCAGCGTGCCAGACGATACCAACGTGATGACTGTGAAAATGGACAGACTCACGAATGTCGACGCAGTT
GCTCAGCTGCTGTATCGCGTCCGGTCCTTCACGAACGATGATTTCAGGGGTTTGTTTGCTCTTGCTCGCGATCACACGGCGAAAAAGAAGAATGCTCGGC
GTGAGCGTGTGCGATTGTTGGTCGTGGAGCTCCTGCGGTATTTGAACCGTGAACTGACGAAAAGCGGCACCATTTTGCCAGTGGAGAAGCGGCGAACGAT
TATGCTATTGTGCGCCACAATGATGAAGGAAGAGGAGGAGCTACTGACGCGAAGCAACAGCACGAAGACATCGCAGCAACTATTTGGTAACAGCGCGATT
TTGTTTCTGCGGTTATTTTCTCTCGCTGAGGCGTCACAGAACTCAGTCGAGCTGGTCAAGTTGATTCGGTTTCTGCACGATCGGATCGGGCAGCATGATG
GCATGTGCGGACTGGCGTATTTAGGTGAAGATCCAGCCCATGTTGCGGGCGGTGCATCGTTTCTGGAGACCTGTGTGTCACTTCTGAATCGCTTCGTCGA
TCCACAATCGGTGAATCAACCCACGTCGGGGAGCAAGGCATCAGCAAGCGACAGCATTGGGGATGAAGGCGACGACAAGGAAGATGACGACGATGATGGT
GGGTTTGCACGTGAACTGGCTCAGTGCTATCGCTGTCTCTACGATGTCCAAATTCTACCTGGATGCGTGGACCACAAAGCGGGGCGGACGTTCGCGTCGC
TGCAA