Description :
From Genome Similarity Track
Location :
Scaffold_1794:1747- 6006
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1794-fgenesh-gene-0.0Aspartyl protease family A01B

Sequence
4259 bases(100 bases per row)
CGCACCACACGATGACTCGGCGAATCCAATCCGCTTCTTCTCCATGTCGAAAATCACGTCGTACCCGACCATAGTACTGGCACCAAGGACTACAAAGACA
GATCCACACCACCCTCTGTGAGCTCTCATCACCGGCAAATCCGCAGCCACCCAATAGTATCCGACTCGTACCGCCACCGCTGCGTTCACTGAAATGAAAG
TTCCCATAGTACGACCCGTCGTCGGCCTTAGTGAGGTACTTGGACGCTGGAATCTCGAGCATGATGTCGCCCTCCTTGTCAGCGCCTTCCAGTACGATCG
TAATGTTGGGCAGCGACGAAAGGGTGCTGGCCGAGACGTGCATTACGTCGTCACTGTAGTCGATGCCAGCCAGATCCGAGAAGATGCGATTGAACGCACG
CTCGGCCGTCGAGACGAAGAACGTATCGGTCGTGCCGCTGTCGACGATCACCCCCTTACCACTACAGAAGGAATATCCAGTCGTTAGTCTCCGCCATGTC
GCTGAATCTCTCACTCTCCCTTCAGCGGAGCCAACGTACGTGTTGTACTTGTCTGCGCTAACGCCTAGTGTCTGATCCCCGACCAGCACGTCCTTGACCT
TGACAGGGTACCACCCGCCCTCGCCACCGACCAATGGCGAGTAAGCGACCTTCGTTCGGTGGTGGCTGTAGTCGACGCCGCCCATCACGAGCTGGCCTCC
CCTCGCGCTGAAGCACATGGCAAACACGTCGTGCTCGACGCGCTTCTGCGCGACCATGTAGGACATGAGAGTCGCTTTATCGCGGCCAAAGCCCATGATG
CCGTTCTCCTTTTGCGTAATGAACAAGCCTGTCTCTTTGGTCTGGCAGCCCACGGGGAATCGCACACCATAGTTCTTGAGGAACCGCTCCGGGTGCTTGT
CGCTCATGCCGCCAAGCCACACGAGATCGTCCACCACGACCGCCGACCACATACTGCCCTCAGTATAACTCTACGCTCCACACGCAAACCTCAGTCAGCC
ATGAGCGTGAGATTCGATGGGACAGTGAAAGACCGTACCTGGCTGATATAGCACTTCTGCTCTTCGCAGCTCATGCACCCCACGTACTGGTTGCACGTCA
CGTACTTGGCCGTGGTCGATTTTGCCAGGTCAAAGAGCGGGTCCGTGTGCTTTCCGCAGTCCTTGCACGAAGAACACGGCAGCGCGGTCAAGTGGCTGCC
CGTGTCGACGATCACGGAGGCCTTTTGCGTGGGGATCCCGAGATACAGCTCGGCATAGTGGGTCCCAAAGCCTACGCCGAGCGGCACTTGGTTGAAGACG
ATCGCACCGACCGTTTCATTCGCGTGCGCAGCACCGGCGGTCCCATTGGGCCCATGGTCCGGCATGAGACGACGGCGGATGCGCTCCTGCTGGTGCTGCA
ACCGCAGCGCGCGGTGGTCCCACTGGTGGGAGACTGTGTGGCGCATGAGCGGAATCTGAATCGTCTTGTCGGACGCGTACGGGAGCTCCAGGGGCGTCGC
GAGCCCCGCAAAAGCGGCTGCCGCTAGCGCCCATATAGAGACTGCACGTAGCACCATGGCGATGCGGTGGATGTGGCACAGGGGTGATGTGAAAAGGCAC
ACCGTGGGCCAAGTGAGCTGCTCGTCAACGTAGCTCTGGCTTCGTGTCAGTTGCGAATGATGACAAAGTCAGCAGCTCCATGGGAGGGACCAGGCAGCCT
GCATCAGCCAATCATCGTGAGCCAACTCGCTGATTCATGTTTTGATTGGTCTAAAAAAAGAGCACCCACGAATAGTCTTCGCAAATTTGTGAGCGTGTCG
CAAAATCAGCGAACCCAACAGGAAACGGACACAAAACCACAAATATACCCCCCAAAACGCAACACACAAAACCTCGCTTCTGTAACATTAGGAATGTCAC
AACTTCTCTAACATGCGGGCGTCGTGCTTGTAGGCGTCGTGGTCTTCGACGTCGCGATCGAAAATGTCGTCGTCGTCATCGTCGTCATCACTGTCACGAC
CAGTGACGCGACCACTGGGGCGAACGTTGTCGTTGTCGTCATCTGCATCATCGTCGTCGTCGTCATCGCTCTCGATAGAGTCCGACGTCTTCGGCTTCTT
GGTCTTGCGTCGCTGGCCAGGCGTATGGGCGATCAGGTCGTCTTCGTCGTCGTCGTCTTCATCTCCCTCCGTCTCCTTGACCCGACCGTACTTCTTGCGT
GCACGCTTCGTCTTTTTATGGCGCCGAATCGACACGACCGCGATGATGATAAACGCCACAGCCAGCACCGTACCGACAATCGTCAACACGAGCGGTTGAT
CCTCGTCGTCTTGGTTCGCCGTATCGGTGCCAGCCTTTGCGCCCAAATCGACCGCGGTCTTGATGGTCGCAGGAGGGGCTTCCTCGGTCGTCGTCGTTGT
CGGAGTGTGTGTCGTGGCCGGTGGCGCTGACGTTGATGGTGCTGGAGATGGCGACTCACTGGCTTTCGGTTTCTCAGTGGTAGCAGGGGGCGCTGAAGAG
GTGGGCACTTCAGTGGGTTTCTTTGTCGCCTCCGTCGCCGACGGCAGCGGTGTCTTTGTCGCAGTCGGCGTGGATGCTGTGCCATTCACGACCACCCAGG
CCGTTGGTGCTGGAGCCGTGGTCGGTGCTGACGATGGCACGCTCGCGTTTCCAGCACTGGCATTCGACGCCGGCAGAAAATCACAGTTGGCTTCCACAAA
CCCGACGCGCTGGTTGCCCTGGTCAAAAATCACGTCGTGGTCCAACATGATGTTGGCACCAATAACGCCGCCGCTCGCCTCGGAAAGGAAGATCGTGCCG
CAGTACTTGCCCGAGCCTTCCTGCACGAGGTATTGGTCGGGCGTAGCCACCAGCGTCATGTTGCTACCATCTTCGGCACCGAGAACGATCTCAATGTTGG
GCAGTTTCTCCAGATGCTCATCCGTGTAGCCCTGGCACGCCGACGACGACATTTGGTAGTCGAGTCCACTCACTTGCTTGAATGCCGCCAAGAAGGCTTG
TTTCATCGAGCTCGGTAGGTACGAGTCCGTCGTACCACTGTCTACAATGAACTGTCCAGAATGGAGCGTGGCGGTCGTGGCCTCCACGCGAGTACCTGCA
ATCCGCACTTCCCGCAGCTCGACACCATAAAAGCTGAGCGCAGGCCACACAGTGAGACAGATTAGAGAGGCGGATGGGGCAGCAGTGGACCAGATAAGCC
ACGCACTTGTGTCCCGACGTCCCGACGAGCTTGGCGTAGCTGATCTTGCCCTTGTGGCGTGACGTGTCGGGCGCGCCGATGGCCATGGAGCCACCTTCGG
CGGCAAAGCACAGCGAGAAGAGCTTGTTCGCAATCTTTTTTTCCTTGAACAGCTTGGCCACAATGTGGTTATCTACAACCAGCACCATTTGTCACGGTCA
AGAAGGCACGGATAAAGAGAATGAAAGAGCACGGGTTCGTACCATTGTTGGCGAGCCCCATGATGCCATCGGCGACTTGCGTAATGAATAGACCGGTCTC
ACTCATCTGACAGCCAAATCGGAAATGCGTCCCGTAGGTATTACGCATCGCGACGTCGTGGAAACTGTCTTCGCCGCCGAGATAAACAATGTCCTCGACG
ACCGACGCATGCCAACTGCTTCCTTCCATGTACGACTGCGAAATCTCGCACGTCTTCTTGGTGCTGTCGGTGCCGCCGCAGCCTTGGCAGCGGAAAAACG
CCGGGTCGCTACACGTGACGTGCGTCAGCGTCGACGAATTCGTCGTATCGAACGGTTTATCCGTGTGGGTCCCACAAGTGGTGCACCTACAATACCATGT
ATTAAAAAACGGTGAGGTTTCCTGCGCTGGCAAATGCGGAGCTGTTGCGCCCACACGTACCCGGCACACGGAAACGCCATCAGGCTGCTGCCCGTGTCGG
TGATCACTGACGCGCGCTGCGGGGGCGTGCCAGCGTACACCCATGTGTAGTGCGTTCTTTTGAGAGAGCCAATCCATACAACAAACAGTCAGCGTTTCCC
TTCCCCACATTTGGCGCTTTCTCTACGGTCTCACCCCATGCCCAAATGAAGCGGCACCGACTCGAAGCTGTCTCTATCCGCTTTAAGCCGTCGCTGGCGC
TGGTACGCGGCGTTGCGGCTCACAACCTCACTTGGGAGGCGATGCAGTTCCAGCGAAATCCCTGCGGGCGACGCCACCGACAATGTGACGGCTCCAGCGA
ACGCCGCGAGCGCTGCGCCAGCGCCAACGCCGCGGAAGACGCGCACCATGGTGCTCCTT