Description :
From Genome Similarity Track
Location :
Scaffold_821:1747- 2942
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_821-snap-gene-0.5Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
1195 bases(100 bases per row)
TGGGCCTTTGCGCACCGCACGAGGAACCCTCTGCACGTCGCTTGTCGTTCCGGGGACATCGAGCTGGTTGAGATGCTGTTGGAAGCTGGGATCAACCCGA
ACTTCCTCGACAAGATTGCTGGTGCGTCGTTCGACCTCGATCTTTTGTACAACCTGTGCCAGCTCCGCTTTCGCAACATCGCGCACGTGCTGGGGTCTCC
CATGCACGTCGCGGTGGAGTACGGCCACACGGATATGATCGATTTGCTGGTGAAGTACGGTGCCAACCTGGACGTGATTGCGCGCACGAGCTTCTTCTCC
AAGTCTATGCGGGTCACGCCAATATTCCTCGGCGACTCGGTGGATGTCGTCGAAAGCCTCATATATCACCGCGCGAACATCCTCGTCGTGCCTGGAAAGG
GCAACGCGATGAGCACGACGGTGCTGCAACGCGCGCAGCTGAACGGACGCAGAGAGCTGGCCAGCGTATTGAGTGATTGGGGAGCGGATGTGGCTCTGAC
CCCTCTTCACGAAGCTGCCGCGGCTGGGGATTTGGCGACCGTAACGCATTTGCTGTCGTGGGATGTGGATCCGAATGTGCTTGGCGAGTTCCAAGATGGT
GTGAATCGACGAACTCCGTTGCACTGGGCTGCAGTCATGGGGAGGAGCCATGTGATCGCCGCGTTGCTGAAAAGTGGCGCGGATGTGAATGCGAAGGATA
GCCTTGGTCGAACACCGCTGCACTGGGCAACGCGCCACAACTACGAACGGGCAGTGAAGGAGCTGCTCGAAAATGGCGCGGATCCACGTCTGATTGACCA
TGACGGCTTAACGTCACTGGCGTTTGGCGTTCTCGGCGGGCTTGTGAGCGGCCCGTGTGTCGCCATGTTCGTGGACGCTGGCGTCGATGTGAACGAGCAG
ATCAGCAATGAATCCCAAGATACTCCGTTGCATCTCGCACTGCGTCTTGGACATCGCGACGTGGCACTGGCGTTGCTTGCTGAAGGGAAAGCAGATCTTT
ATGCGTTGAACGGTCAAGGCCGTCGAGCCATCGAGTGCAGTGCGTCGGCGGAGCTCCAGTTCGCCGTCAAAGTGGCCGGCGATTGCGTTGACGTTGTGCT
ATCTTTCGATCCAGTGTTTCGCCAATTCGCTGAGCGCGTTCGCGCAGGCATCGAGCAAAACTACATCACAGTGTACATGCGGGATGACGACGACG