Description :
From Genome Similarity Track
Location :
Scaffold_111:174695- 177802
Transcript NameFunction/comments
Hyaar_Emoy2809861hypothetical protein
Hyaar_Emoy2809862conserved unknown protein

Sequence
3107 bases(100 bases per row)
GCTTGTACGCATCAAGGGGCAATGAGACGACTGCGCATCTGACCAAGGCGTCTCGCTTAAACACTTTCGAGCCCTGAACGAGATCATCCCATTTTAGCAG
TGCATGCGTCATTCGGTCGCGTAGATCGCGAATCTGAGATTGCAGTGTTGACTCGCTAGAGGCGGACCGTTCTATGTTCGTAGTGTAGTGCTTCCAATCA
TCCAACAATGGGATGAAGCGCTTCCGCAAGCGAAGAGCACCATCACCCAAGTTTCGAAACAGTGCGTCATTTTCAGACGACTCCTCACACGCCTGCTTGG
ACACTTCCACGGTCAGGCGATATGACGAGCTACCGAGACCATAGGCCTGCACAATATCGTTGATATCAAGTGTATCGCTGTTGCCATCGTCTTCGTCCGA
ATCAAAGTCTGAAACAGCATCACAAGAGTTGTTGTCTTCTGCCGCGTTTCCACACTTCACATCTTCCCGTGCATCTACTCGTTCTGTTGATGGTACATCT
TCCCATTCAACATTCTCAGGATCATCCTCGTCGCATTGTGTGCTGCACTCGACGTCGCTTTGTACATCATTCTTTGATTCACAAAGTTGTTCCTCTTGGT
GTGCTGCAGCTGCATTTCCATCAGCTGACAGTAACGGCCGTCCTCTCTCCCCATCGTCTGGTAGAAAAAAAGCATCCATCGTCGGCACCAAGATCTCAAA
CACTCGATTCATCTCCACGAGCACTTGCTCCATCTCCGGCACATACCGTTTCATCTCTCGATCTCGTTGCTGCTTTTTCACAACACTTACTCGCTCTCGA
TGCCGTAGAGCATCCACAGCTTGCTCGTCCTCCTCTTGCTTCTTTTCACGTGCGTTCGGGAACACATACCCTCTCTCCGTCAGTACTGCATGACCAGCAA
CAAGAGCCGGATATCTCTCCCCGAAATCTTCTTTCCAATTCTCAATGAGCGTCAATACCGCCGTCACGTGCGTCCAACTCCGACTTCTACCGCGCAAAGC
TTTCGACGCATTAGCACTTGGGGTTGCTCCTGCAGCCACAAGCATTTGATCAAAAAATGAAGCGGTCTGCGTCGAAACGAGTGCTCGGAACACTGCTGAG
CGCTTGAATAGTTCTCTGCACAGCTCAATTGCCTGCACAATATTTCAAAACAATCAAATTATATTAAAATGTGACAAAGATAGAATAACAGTGGCACCTC
ACACGATTACCACCGCTACCGTTACCAGCGAAAATTTCAAGAAAAATAGAAATAACAAAGGACAAAGACCTAAATTAAAACAAAAAAAGGGTGACAAACC
TTCGAAAAAATAACAGGTGAGTTTTTTGCCCGCTTAAATTGATGCAAAAGCAGTGCATAGAGTCGCTGAATGTACTGAGATTGCACCGCACTGTTAGCGT
CACGCAAGAGTCGCTTCAGTTGCTCCAAGTAGGTTCCAGAACAAGTTTCCGAGTCCTTCGATGCGTCTGTTGACTTGGCTCTGCGTCCATCACGACGTTT
GCCACGTCTCTTCTGACCAGCTGTGGACACACGGAAGTAGCTAGACAAGACGTCATTGAAGCGAGCAGCTTCGTTCGCGGCGTTTAATCCATCGATGTCT
TGCGACATTTTAAGCGACGAATTAACGACTTATTCGACGGGTCAAGAGGAAATAACGCAGTAGGTCACTCGAATATAAACGACCTTTCGTTAAAAACAGC
TTGAAATTGGGTACTGTTATCCTTAATTAGGGATTGCCTAAATATTAACCAATCAACGTGAGACTCCGTCAGTCAAGCAGTGAGCTAGTCACTCATTCGA
GTGAAAAAAAACTTGTCTATTAGTGACATCAGTCATCCAACCGTTATGGGGAAGAAGCGAGTGGACGTCGGACCCTCTGCGCGCAAGGAGCGCGGGCGCC
ACAAAGGCGCAGAGGATCCGTCCTGTCGCAGAGAGGACGAGAGTGACGCCAGCTACCGCCGTCGCGCATTTCCGCTGACGCTGCGCATGTGGGACTTCCA
GCAGTGCGACGCCAAGCGCTGCACGGGCCGTAAATTGTGTCGCTTGGGTTATATAAAGAGTATGAAGCCGGGGATGCACTTCCGAGGGCTCGTGCTCTCT
CCAGCAGGTGAACAGGCGGTATCTGCCGCAGATAGGGAGCTGGTCATGGGCACGGGCATCTCGGTGATCGACTGTAGCTGGGCCAAAGTGCAGGAGTTGC
CCTATAAACAGCTCCGGTCGGGCGTCCATCGACTGTTGCCGTTCCTTGTAGCTGCTAATTCCGTGAATTATGGCCGGCCACATAAATTGTCGTGTGCTGA
AGCGATTGCCGCGACGCTGTACATTGTCGGGTGTCAAGACGAAGCAAGACAAGTCATGGACGAGTTTTCATGGGGAGCTGAGTTTCTCAAGATTAATGCG
GACTGTCTAGCAGCCTATGCCGCTTGTGAGAACAGTGCACAGGTTGTTAAGGCTCAGGTAGGAAGTCTTTTTGTTATGGGGGGATATAGTGGAGGTGGTG
GTGGTTGTGCTGATGGAGTGTGGTTGTGGGATGGGTTGTGGACGTACAGAACGATTACTTGGCTGCATGCCAATCCGAGCATAAGGAACGGCAGCAGCAG
ATGAAGTTGCCGAGCCTAGAAGACAGTGATGAAGATGAGGAAGAGGACGAAGAAGAAGACGTGGAGCTTGATCGCTTTGGCAATGTCGTGGTACCCCGTC
AAGTGTCGACTGCAGTGGAGATGAAGGATGGTACCGTTAGCCAGGAGTCTCACCAAGAGCTAAGGCAATGCGAAGGTTTAGTGATCACGTCGCCTTCTAG
TGTACGTAGCGAACGACTGGACTCTGACGAAGAGATTGCGGGCTTGATGGAAAACTTGCACCGTGCGGTAGACTCGGTCAAGAAAACGCACAAGATGCGC
GAGGACGCTCGTAACGCCCGTGAGTTGGATAGTGAGAAAGCATATGCGTTTTCTTCCATGGAAGACGTCCACCGTCAACAGGTGGCGACAGTATGCTTGG
AACGAACTGCTGTGGCTGTATCTGGTGATGCAGTGCTGCAGCTCCCGACGTCTGTTTTCCACCAGTGGGAACAGGACGATGCACGTCGAGACCGGGATAG
GTCGTAG