Description :
From Genome Similarity Track
Location :
Scaffold_86:174681- 176265
Sequence
1584 bases(100 bases per row)
AGCCAAAGCTAATATGTCCTGTGTGTCTGCAGGAGCAGGGTCTTGAATTCGGCCTGTAGCGAGGAGACGCTTGTGAGCTGCGATACATTCGTTTAAAGCG
CCAGACTTGTGAAGCGGACACAACGCGCGTAATACGCTCCCAGAACTTTTAGCATTTGACTTCAGAAACGAGAGTATCGAATCTTCAGCACGGCGACCGA
GTTGAAGCACCTGATCCTTGTAGTCGCTGGCCTGTGGTGCTAAGACACAGCCCTTGTCGAGGAACAGTTTCATGAATGCGACGACGTGGCGGGACTCCGA
TTTTTTCTGGCGGTCGGCTGACTCCCAAACGCGAGGCACATGCGTGTACCACTCGAACCACGTCGCAGACAGGTGTGTAGCTTGTTTCTTTCTTAGCTTT
GGCTTGACTTCTTGGTCTGACGATTCCTTCACCTGCTCTTTTTCAGTTCGCTTTTGTTTCACGTTAGGATTCGCTTGTGCAGCCTCGACGATGGTTAGGC
GTGCCGCCAAGAACTTGTTCGTGGCGATAAGTGCATGAATGATAGCTAAAAGGTGATCCATTCGTGCGCACTTGTGTTGGTTGAGATCTTGTACTTGAGC
TTGATCTTGAGCAGGTAGAGCAGCTTCGTTGCCGAGCGTAAGGGACCATGCGAGCACATCAGCGATCGGAATATCCGCAGCCTCCAAGCACTCTTCAAAC
CGCGAAGCGATCGGGGCCGATGGGGAGAGTTCCTTGAGTTGTGGGCAATAGCGGAAGAGGTAAGCCGTGAGAATGCCGAGGACCTTGGTGCTTACATTTC
GACGTTGCTCTTTGAGTCATGTACAGGAATGAAACAGCAATGCCTGCAAGCGGCCGAACCGCTCTCGACTTGAATGGTCGAGCACCTCAACGTCAAGCAT
TGTTGGCTTCTCGTCCACGGACCAACCACTCAAAACCCGAGCGACCTTTCTGTCCTTGTGCGCCGTGTTGGTAATGTAGACAAAGGCCTTGTTGGTCTTC
GTCATTTCCCAAGCGCTGCGGTCGAAAATCCACTGGGCAGCTACACGGTCATTGCCGTTTGCGTGTTGAGCTCCGCCACGCCGGAAAGAGTGCGAGGTCA
GATCGAGTGTGGCTCCAGCCGGCTCAGCGACGCGCTTGAGCAACCGGTTCACATAAGCTTGAACGCCATCTTCTCCTCGTTTAACATCGCCGGTTGGCGC
CTTGGTCTTTGCGGGTCCTGCTGGAGTTTGCTTGCTTGTACTTGTAGGTAGCGACGAGGGCTCGATCACCGGCGCCATCATCGTATCCGCAGCCACGACG
GGTACCTGGGTCTGGGTTAGTACAACTGCGACATCGAGCGAGGCCGGTTCTGCTTGTAGCAAGTCCTGCAGCGGGATACCTTCATCAAGAGGCACGGCGG
CGTCAGCCACGAGTTCGGGTAGTTGGGCCAGCAATGCCGCGTTTGGTGCATCCTGCGTCGCTAGCGCCACGGCGAGAGCGTGCAAGGGGCACGCGAGAAA
GTCGCTCTTGTCGGGAATTAATGTAAGCCCTTGTACTCCCGAAGTCTTGACGCGTAGCAGTCTAAGATAGAAGGTGCCGTCCGC