Description :
From Genome Similarity Track
Location :
Scaffold_30:174648- 191953
Transcript NameFunction/comments
Phyra_78244ATPase family protein
Phyra_78245Hypothetical protein

Sequence
17305 bases(100 bases per row)
TAAATTATCCGGACACGTATTGGTCAGTTTATAAAACGTACGAGACAACAAAACCCAGCATCACGTGCCATTACTAAAACATGTGATGATATTTCCTCAA
GTACATCCTCTTTTCATACGTCTCGCCTCTTCCACTTGTTTGGGGTTCCCTAGTTGGGCATAGGACTGTGATTTGAGTACTGTACTGCTTTTACGTACTA
CTAGCAGTATACTGAAGTAAGATACTAGAAGTACGGGCAAATGACAGAAGGGTGGTCAATTCAGGTTAAATACAGAAAGCGGGTCAAAGGCGTGGACGAT
TTGCTGTCCACGCCTCTTGACACAGAAACCTTGCAGTATAACATATCCGGATCCAAGTCTCACAGTTTGTGATTCGTCCCCACAGATGCGAGGAGCTTGC
CCGCAAAGGTATGTGAGGCGTTTGCCCACACGATCGCGAGGCGTTAACCCACATGCAACTAACGGAATTGGCCGGTCCTTCCTTCTCTGTCATAGCGGAG
CGAATAGGTTTTTGGACTAGGCCTACTTTCAAAAGCTCAAAGTGTATTCATGTAGAGTTATTCGTAACAGCAATTGATGGACCCAACGGAGTGCTTGGGA
ACGCAGCTTCCGGCTGTGTAGCCAGCTCCATGGGAAGCGAGAGTAGACGATCAGGTTTGCGATATTGCAGACGACACAGGAATTGTGAAAGTAAATTATG
AAGCCTCAAAGTATGAAGCAAGATGCTGTTTGGCAATCTGCTTTGCACAAATGGATGGCTGCAACTCATTTTCACGATTGAATTAATAATGCGAACACGT
ACGATGACATCGCATCCAGGAGCTTATCTCGGCTGGTGTCACTTCGTCAAAAGTGTACCATGCCGAGTGACATTAAAATCGTGTGTTGTCAATATCGACT
TTCGAGCCACGCCATTGGCTCAATATGGTAAATTGACCACGCCTTTTGTCATTTGACCTTGTATCAGTACATTGTATACATTTCCTGGACTGTCGAGGAT
CACTCACATTCTGTAGTCACCCTAAACGGGATTATGCTGTTTCCCTCTTACCCCCCTCCTGCTTAGTAAACGGTGCTTACGACCTCGGCGAGGTTACGAT
TGCTTACAGACCACTGAGCTGAATAAAATTTGCCCGGACGGTCTCCGTCATGTATGCAATCTCGTTGCAACCCAACCATCGGTCATTATCAAACAGCTCG
TTGGAGCCAGCCATGCCCGTCTTCTCGCTATATCCGCCCAACACCACGTCGCTGAGTGATAATGTGATCTGCGCTGTCACTCAGCGCTCAAACTCGAATC
GCAGGCACGCCGCTGTGGCCATGATTGAAACGCCACCGGAAGCCATGAATGCCCAAGCACCCTTCCAAGCCTGCACGAAACCCTGCATGGCCAACGAAGC
TACCAGTACCAGCAAACACCAGCAAAACACTCGAGCACAGCGAGAACGTCGCAGAGTGAACCAGGCGAGATACCGGAAGAAGCAGCGCATGTTGACGCTC
GCCCTCGAAAGCGCTAACTCAAAGTTACGACAAGAGGTTGAGGAACTCAAGCTGAAGCGATGCAACACTCACATCGGCATCCCCACCACACAGACAGTCT
GGACTGTGGCGATGCATTATTTCCGCATTTTCCGCTTTGGCCTCAGGTCCCCTCCGCCATTGCTGCGTGACTTCGTGCTGAGCTTTCTGCAAAACGCTAT
GGCCCCGGACGTGACCGACGGCTCGATTTGCGGGGTGGATGCACTGCTGGAGAACTGGAGCCTGTTCTCGGTCTACTTTGACAATATCAACATCCAGCTC
GAGCGCCTGGAAATTGGTGGTTCGGTGAACTTGGTGATGGCAACCACGACTACAACTGTCACCATTTCTGCCGACACGCTACGACGGGTATTCCCTCACC
TGGTCGCTAATGAGGAAGGTAACAGCCTCGCCACCAAGCTGCAGGGACGCTGTATCTCGATGCGTGGGTCAGTGCTTTTCACCTGGGACGACAAAAACGA
CTGCGTGGCGAGTATGCAAAGCCGATCGGACATGCTAACGCCATTGCTTCAACTGCTAGGAAACCTGGAGGACGTATCTCGCGTATTCGACAACGCTCTT
GTTACGCCTGAATGTAGATTGACAAGAAGGGAGGGGAATTGAGCTCGATCATATCGTGTTTGTTAGTGGCCAGGATCGAGCTCTGTAGCATTAGTCTCAA
CGAAAAAGTAATGCCTTTTGGAGCAGGATACCACAGAGGATTGTCAATCCTCGCTGCCTTTTGATTCAACTGTCATATCCTCATGGCAGCGTCTATTTGA
AGTGTGAGCGCCTGCTGCAGTAATGACGCGTGTTACAGAAGAACCCTCCGTTGATGAAGAGAACATTTTGCTGTCACTACTCGCATCCTGGGGCACAGTG
GTGAATCGCCCGAGATCCCGTTCGTAGAGTTTGGTGCACCGCCAGTGGATCGCAAGGAGAGACTGCAAGTGCTTCAGAAGATGGTCGCGCATACTCAGTA
TTGCCAAAGCGGAGACCACACGGTTAAAGCTGTGGAACGAGGCGTGAAGCGTGTTGCTGCGCTCGAGGGTGACGATCGGTTCGTGTTTGTGGTGAGCGAT
GCCAATCTGGAGCGATACGGAATCGAGCCCGGATACCTAGGTCGGAAGCTGCTCGCGGAACCTGGCGTGCAGGCTCACGCTCTTTTCATTGCCTCCTTTG
CCGACGAGGCTGAGCGTATCCGTCGCGAACTACCCGCAGGGCGTGGCCATGTCTGTCTTGACACGTCGGACTTGCCTAGGATGTTCAAGCAGATCTTCAC
ATCCGCCTTTGGTGGGAGCTAACTGCAGTGTTCCGCAGACACCGACAATCTACCTTTGAGCGAGCTTACTATTAAGCTGAAAAAAAACTACTTTTTCGTT
GAGACTAATGCTACAGAGCTCGATCCTGGCCACTAACAAACACGATATGATCGAGCTCAATTCCCCTCCCTTCTTGTCAATCTACACTCGGGTGTAACAA
GAGCGCTGTCGAATACGCGAGATACGTCCTCCAGGTTTCCTAGCAGTTGAAGCAATGGCGTTAGCATGTCCGATCGGCTTTGCATACTCGCCACGCAGTC
GTTTTTGTCGTCCCAGGTGAAAAGCACTGACCCACGCATCGAGATACAGCGTCCCTGCAGCTTGGTGGCGAGGCTGTTACCTTCCTCATTAGCGACCAGG
TGAGGGAATACCCGTCGTAGCGTGTCGGCAGAAATGGTGACAGTTGTAGTCGTGGTTGCCATCACCAAGTTCACCGAACCACCAATTTCCAGGCGCTCGA
GCTGGATGTTGATATTGTCAAAGTAGACCGAGAACAGGCTCCAGTTCTCCAGCAGTGCATCCACCCCGCAAATCGAGCCGTCGGTCACGTCCGGGGCCAT
AGCGTTTTGCAGAAAGCTCAGCACGAAGTCACGCAGCAATGGCGGAGGGGACCTGAGGCCAAAGCGGAAAATGCGGAAATAATGCATCGCCACAGTCCAG
ACTGTCTGTGTGGTGGGGATGCCGATGTGAGTGTTGCATCGCTTCAGCTTGAGTTCCTCAACCTCTTGTCGTAACTTTGAGTTAGCGCTTTCGAGGGCGA
GCGTCAACATGCGCTGCTTCTTCCGGTATCTCGCCTGGTTCACTCTGCGTCGTTCTCGCTGTGCTCGAGTGTTTTGCTGGTGTTTGCTGGTACTGGTAGC
TTCGTTGGCCATGCAGGGTTTCGTGCAGGCTTGGGAGGGTGCTTGGGCATTCATGGCTTCCGGTGGCGTTTCAATCATGGCCACAGCGGCGTGCCTGCGA
TTCGAGTTTGAGCGCTGAGTGACAGCGCAGATCACATTATCACTCAGCGACGTGGTGTTGGGCGGATATAGCGAGAAGACGGGCATGGCTAGCTTCAATG
AAACTTTGATAATGATCGATGGTCGACTGAACCACACGAGGCGAAGGAGAGCAACAGCACCACCACGCGATTATGACGTCCAGGTGTACGGATGAATACT
AGTAATAAACAAGCATAACCTCACTGAGGTCGTAATCAGGCAGAGCATGAGTGATCCTGGACCGTGCTGATAACAACGCCGTGCGCTCTGAAAATTTGAA
GAGAGTGAGTACATATACTTCGAAGTGTACGATTATCATGCAAACGGAACATTCACGTGGTCACTGCCTTGCTGTCTTTTTAAAAGACCGACCCGACCAC
CACTATTAGCTAGCTGTACACCGAAGCTGTTGCTTGGCGAAGCTTATATGTTTGAGTTAACTGCTACGAAATGGAGTGTTTGAAGGAAGCAGCACTCTAC
CGGTGGCGGCGACGTATTTTGTCAGGGTTGCGACCATCGTACTTAATACGGCTGATAGATGTTGGTCATGCGCGACTCCCCCATTTTCTCTCATTCGAGC
CGTGAAGGAGAAAGCGCTACTATTGAAGAAGCTGGCAAAACGATGTTGACTGCGCTCATCGTGGAAGTACCAGGGCGGACGAGACCACGGGAGGAGTCAA
AGAAGAAGCCGAAATCCCGGCGAAACGGCAAAAAGGGACGAAGTGGGAATGGAAAGAGGAGGAACCCCTATACTCTCTTGACTCAAGAGTCTTGAGATCT
CCAATCCTTTCTTTGTGAACCGCGATCGAACGACGGCCCAGCTTCTAGACTCTAGAGTGCCACAAAGCCAAGTATGATCGTGGAAATACAGGTGGTTTGG
AATGGACGATTCCTCTTGTAGACCGTGTATTCGGCCTTGGGAAGTCAACTTTCAGTTATGACTTCAACAGGTGGCTGCACCAGTGACTACGACTATGGTC
GGCTTCTTCGACGAGGGTCCCCGGCAATCCGGGCCCAGGAGGCAGCAGAAGCGTCATGGTAGAGGTCGGAACAGAAGTAGAAGAGGCGAGGCCGGTGTGG
GCGGCGGCAACTGCACTAGGACGGCGCACAACGACAAACAATGAAGCAGAATTGTGGGGCTGCACAAGCTGTTGGCCCACGCGGTGTCACAAGATTGGAC
TGACATCCACGTAGTGGGGGACAGCGCAATGATACTTCGCATGATGCGGACGAGGACGCCACCCAAGGCCAGCCAAATGCGACACTGGTATCGCATCAAT
TGCAGATTAGCGGATATATGCAGAGTGGAGAGCTGGACTCACCACTACAGGCAGCACAACAGGATGGCGGACTGGCCGGCGAATGTGGCGATGGACACAC
ACCAGCGTGATGGCAGACATGGATACGGACGGCACCAAAATATGCACTGTGTAAAGGGCTGGAAAACCGGGTGAAGGAAGATATGAAGCAATGGAAACAA
GAGAGAGCTCGGCTATGGAGGCAGCGATTGGGAGGAGGTCAACAGGCAAGTCGTCAACTCACTGGTCAAGATGTAAATACAGGACTGGAATGGTTATTAG
AGTTCATTTCTAGGAATAGAAACAATAACGCAATACACCTCAACTACCACAATACAAACTTTTTAGCTATGAGCACATTCGAAGATGCAAGCAACANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAATCCGGAAACGCATCTTGGAACAAAAGCAAAAAGGTGTTCCCACGCTCGGA
CTTCGGCATGTGCGTCACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGTTTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTG
CCGCTGGCACAATCAACACATTCCTTCACATAGCGTTCCACATCCGCATACATCCCAGGCCAATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAGTGA
TGCCTTGATGGCCGCCCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGACTTCGGGACGACCAGCCTTGGCTCATCCACAAAGTCCCT
CGGGCGGTCTCGGGTAGATCGTGCAAGTCGGTACAGCACATCGCGAGTGTCGAGCGCAAACAAGTCAGCAACTTTGGCAATCTTTCGGAGGCGTCTGGGT
GATAATCTGTCAACTTCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTCCTGATGAACTTTGATGCGGCGCCATCTTTCCGCTTGGA
ATTCCAGAGGTCCCATTGGTGGTCCATCCAGAGATTCGGTGGTTTGAAGGCCTGACCTCGTCATGACTGCCATCACTCTGGCGGCTGCCGACAACGGGGC
AGAATCAGCATCAGGAAGCACCGTTCCTACCTGAGCGTCCCTCGCATCCGAGCTTCCGGGTCCCACTGGACTGGAACTGTCATCGCCATCTGGAGTGTCA
GTCTTCGTGACCTTTTCGGGTATTTTAGACACTACTTCCAGGTGTCGGAGCTCATGTTCATCTTGGACTTCCCATGACTCACCCAGTAGCAACGTCTTGG
AAGTCAAGTAATCGGCGGCTTGATTGTACTCCCTTTTGAGGTGTGCCAGCCTTACCGTCCGGAACTTGGCCTTCAGAACATTAGCCTCCGCGAGATGCTT
TTGCAGGTGAGGCTGATTGCAATTGATTAACCCTTGCACTTGCTCAATAACAATTCGGGAGTCACCGACCACGAATAGATCTTCGACATGATGTTCGAAA
GCCATCGTCATACCTTTCAGAAGTCCGTAGTACTCAGCGTCATTCACAGTAACATCTTTTAGAATATAACCATGTGCTTCTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACATGCCTTGCACCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACACGATC
TCTATCCAATTTGCTCTTTTGGACCTCCTGGATGAAAAGGGGATTACTTTGACAAGAACTACGGTATCCGACCTCGTGCTCTTGCGCACACGGTTTCGCT
CGATGTTTTGTTCGGAGACATTTGACGAAGGAAGGTGGCCCACTGTTCATTGTGATCGATGAGGTCGGCGCAGCGTTTACGAAAGTCATACCCGATGATG
ATGTCTCCAAAAGAGAACAATTCATGATGTTCTGCAACGATACTCTGCTCCCGTTATTTCCTGTTGAAAAAGTTGTTTTTCCTGATTGCTGGTCGCGCGC
CACCCCTGAACTACGTCGGCTTGAGATCACTGCCAGATCCAGGGCTGAGCAATCGCTCTTTCAAGTTTCAACGACTCAGCCTTCATCTTCTTGGAGCCTC
TTCGATTAAAGAAATAATCAAGAGGATTTATTGGGACAACAAGGAAAAGGAGACGATCCAAGAGCACTGTAAACTCGACGGCAAGCAAGTGACCGAGGTT
GCTCACCATCTTTTCAAAACGACGTTTGGTCACCCGCGGTCGTTGGTCTACGCCTTTCGTGCGTGTGATTTCTACCGCGCACTGTTGCGTACGCCGCGCT
TGATGTACCCGATGCCAAAATTGATTGGAAGGATTTTGATCGGCGCTTGCGGATTTACAAGGCACCTCTTCGACGATTGATGAATTGTGCAATCGAACAG
AAGTCAATGGACTTGTCAGAGATCTGGACGGACTCGGGAGACAAAGCAATCGCGTTAGACACCATCGCCAACGGTTTTGGTATTGCGTGGGATGGGACAG
TGGATACTGCGAAGCTGTACATACCGTCGTATATCCGGAACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTCGATCAATCCAGTTTCCAAGAGTCTCTGAGTAAACTCATAAACCTTGATAGCCAAATGAGGTGCGATGGATC
GGGCGCGTTGTGCGACCGGCTTGGCCGTCCCAACGTCCAAATCACAAATCACTCCTCTTGCCGGAGCAGGAGCGGCATTTCCATCACCCAGAAAAATAGA
GCGGTGGTACTTCAGGATGGACCGAAGCTTCTGCTCTTCCAGAGGTGATGTCGTTTCCGAATCTCCCACATCAGCCGCATCAATATCACATGTCGGGCTC
AACTCTTGGAGTTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGGATGTACACAGCGGGTTCCAAATCCAGCTCTT
CTGCGTTCAGACGCATGCACCTCTCATACTCAATTTCCAACTTTTGGATTGGGGTACAGAGCATGGCTTGGGTTTGCGGATCCCGGAGTTCGTCCAATCC
TGACAAGTCATCCAGACAATCGTTCACATCGTTAGCACCTTCATCCGGAAACTCTTCATTCAGACTAATCGAATCAAAGAATTCATCTCCGTCCGAATCC
ACGTCGTCCGTCAGAAGTTCTGCGCCTTCCAAACGTTCTTCAACCCTTGGTATGACCTCCGACTCCCTTGGATGACATCCGTCGGCAGTATCTTCCGGAC
GTGGCACTTCCTCAACCTCAGGGTCCTTTTTCAGCTTCACCGTGTCTTCTGCGATGACTTCATCTGGAAGAGTCTCCTCCACTTTCGGACGTAAGACACG
AGGCAGATCCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAACCAATAGCTTAGCCGGCCATGAGTATTCGGACTTCTGGACGCAA
GGAGGTTCGGCGTCCCTCATCATCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGAGAGTCTGCCACTCCTGAT
ACCTTCGGAGACCCGGGCGGACAAAACGTCCCGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCAATCGGCGTCCGAGTGTCAATGCTAAGACACCT
TCCGGAAATGTTCACCACTTTGATGGCCACAGNCCACGATCTAGCAGCATAGATGATCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCAAAAGGAAGTTGGGCTACGAGCTGCGGAGAGTTGAAAGCTTAGAAGACGGCTTCGGGCCGAGATTGCAAAACCAAAAGTGAGATTG
ATTGAGTGAGTTTTAGCTGCTAGCCTGCCTCCTACGCTCTCTTGTCGGCAAAAAGAAAAACGTCCATGTGGGGACTCGAACCCACACCCTACGGATCAAA
GACCCGGCACTTAACCCACTACACCATACTGCATGACCAAAGTCACGCACACCCTACTCCTACATATGTAACTCTTACTATGCACCCACACGCATGTCCA
CGCCGCTTCAGTACTTGGACACGCTCCCACACGCTTGTTCTCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCTACAAATCCCCCC
GCACACGCGTAGAGGCACGCGCACGCACACATGCCTTGCACCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACACGATCTCTATCC
AATTTGCTCTTTTGGACCTCCTGGATGAAAAGGGGATTACTTTGACAAGAACTACGGTATCCGACCTCGTGCTCTTGCGCACACGGTTTCGCTCGATGTT
TTGTTCGGAGACATTTGACGAAGGAAGGTGGTCCACTGTTCATTGTGATCGATGAGGTCGGCGCAGCGTTTACGAAAGTCATACCCGATGATGATGTCTC
CAAAAGAGAACAATTCATGATGTTCTGCAACGATACTCTGCTCCCGTTATTTCCTGTTGAAAAAGTTGTTTCTCCTGATTGCTGGTCGCGCGCCACCCCT
GAACTACGTCGGCTTGAGATCACTGCCAGATCCAGGGCTGAGCAATCGCTCTTTCAAGTTTCAACGACTCAGCCTTCATCTTCTTGGAGCCTCTTCGATT
AAAGAAATAATCAAGAGGATTTATTGGGACAACAAGGAAAAGGAGACGATCCAAGAGCACTGTAAACTCGACGGCAAGCAAGTGACCGAGGTTGCTCTCC
ATCTTTTCAAAACGACGTTTGGTCACCCGCGGTCGCTGGTCTACGCCTTTCGTGCGTGTGATTCCTACCGCGCACTGTTGAGTACGCCGCGCTTGATGTA
CCCGATGCCAACATTGATTGGAAGGATTTTGATCGGCGCTTGCGGATTTACAAGGCACCTCTTCGACGATTGATGAATTGTGCAATCGAACAGAAGTCAA
TGGACTTGTCAGAGATCTGGACGGACTCGGGAGACAAAGCAATCGCGTTAGACACCATCGCCAACGGTTTTGGTATTGCGTGGGATGGGACAGTGGATAC
TGCGAAGCTGTACATGCCGTCGTATATCCGGGACGTGATATTGGCGTCCGTCTACTTGGTCAAATACATCCTTGGAAAACTCGTACCTGCAATTGGCCAA
GTATCGATTGACTATCTGGACATGTTTGAGCTGCTTTTCTTGGCACGCTTCAAAGAGCTATGTCAGAAGGAGGCTTCCCAGCTTCTTTACCGAGAATCAG
GAGTTTGGGCGCTGCACAGGAGTGCACCTCGCGACGTCGACGTATTGGATGCCGAAAATAACAAAGAGTGGGAACAAGTCGCCCAACACAGCCACCGCAC
ATCCAGATCACTTGGATTCCTTCATGGCGGAAATTGATAACCTTGTGATTGACGAACGTCGAGTGAATCTGAAACCGTTTTCGAAGTCAGCGTCGCCAGA
CATCCTGCTAGTGACGAAGGTACATAACAAACCGCTGACGGTGGGTCTGGTTGTTAAACAATGTATCCGCACCGAGGTCAAGAGGACGACGGTGGAAGAC
GAGTGTGATCAGTTCAACAGGATGTTTGAATCCAAAGAGGGCCGACTGAACGTACTGGTCGTGTGCGCGACGGTATATTCTGCCGAGCTAAACAAGAAAT
TTGAAGCAGAGGATCGTCCGGTCTCAAAGTCGGCCATTTATCCCAGTGGTGCCTTCAAGCAAATCGACGAGGTGATTCTGCTGAATTTTTCGACTCCAGA
GAACCGTGCCGAGTTTTTTGGGACACAAGGGGAGGACACGCTCATGAATGTGTTGGAGAGTGCCATCGAGAAAGCCCCGGTTCAATATATCAACCATGTG
TAGAACTAATCGGGCGAGTTCGCTCGGCAAGCGCTCGTGGGGAAAGTGTGATGGAGAGCTGGTAGTGCCGTTAATTTGGCGACAGTTTGATTTTACAGAC
AGAAAGACGTAGGCGAGTAAAGGCGTGGCTTTGGGTCAAATGACAAACTGGACGACTTTCACGGGTGAACAAGCCTGCTTCACTTGACCTTTCAAGCTTT
GCCTTTCATTTTTCTCGTACAGTGCCAAGCTGATGAAGCATTTTATAAGGGTGGTAACAGGTTTCTTTGCGCCCGGTCCGTGACGCTAATGCTTGCAGCT
AAGGATGCAGTGCTGCTCGAGTGCGTCAGTCATTGTATAGCTCGTTTATTTATCTTGTTTTCGTAGAAACTACATCAAGTTGCCATTTGTAACCCCGGTG
GGAATGGCGACTGCACGCCCTGTGGCGTGATATGCACAGGAAGTGGTGGGCTTATCTCTCAAGCAGACAACCTTAGCTATTGCTAAGCGCTAGGTGGCTC
TTTGCAAAATTTGTGGTGGAAACCTGTTCACGCTGGTCACTGCGGCTCGCACAAGTGGCGCATTGCATATCTCGTTTTCACGTTGACATGTAGATCACCA
ACGCTCTCAACGTTGAACCACCAGCATGGCATGTGAATGCATGCAGCTTTAACCTGGACAGTCATCTGCGTCCTGGAAACCTTATAGTGCCTCGCAGAAC
TCATAAACTGGATACCCGAACGAGAGTCCGCGTCTCTATTGGTACAGTAACAATCAAAGAGCTGGCGACCGAAGGCGCTCCAGACCAACACTCCGAATGA
ATATGAATGACCCAATTCGTTCAGACGTAATGGAGACCTCGGTCCTGGATTTGAGAACAATGTACAAGTACTGTGTAGTAGCAATACTAAAACATCGCTT
GGTCCCGCAGATTCCATAGCAAATGTAAATGAGCCATCGCCTTTCGTTTGCTAAGGAAATATGCGTAGTACTAACGCGGCGCATACCCTTGCAATTTATT
CACGCTGTAAAAAGTTATGCTCGGTCTGCCCAGAGTTCCTCACCATAATCTCGTGCGATTTTAAAATGTAAAGTGAACGGTCTAATCCTGCGATACCCAT
GCAGCACCGGCTTCTTAAGTGTCAACCTTGTGGAAGGCACAAAAGTACTTTCATTTGTCTGATCGAGCCTGGTGGTATCGGTCTCATCGATCGTTTACGA
CCTTGCCCTCATAAGCTCTTCTTATGAGGCGGGTGGGCTACTCTACCTTCCTACAGCAGACACTCGAACCACTTCACTGGCATCTTGGCATCGTTCAAGA
GCGAATCGCCACTACGGAATGCTGTATCGGCGTGATTGATCCTCGGCGTGTAGAAGCGGTCGCGATAGGTATCGCCAAACTCAGATCGCGGGATGCCTGC
AGCACAGCTCTGGAACTCCACCAGGCCGTCATTCTCGTCCGATTTGTGTGGAACCACGTTGGCAAGTGTCCAATAAAGCGGTAGGCGAAGCGATAAGACC
CCGGAGAACCCACTGCTACACATAAGGGCGTACACATTTTTCCGATAGGCCTCCTGCGCAGCAGCGTAAGCTGTATCCAGTTCCACAGAGCCGTAACGCT
CACCCTCGTACGCTAGAGATTGGATTCCGGGACCAGCAGGGCAAAAGCCTCTCAGTTCCACGAGCTTATCCAGAATAAAATTTGTGTCACCCTTGCACGA
ATCCTGGAAGTAATCAGAGACCATACTTCCTTTCATTGGTGCAGCAGAACTTACCCACGTCGAACTTGAAGCCAGGCTGCACTTGCCATTCGCGATTGCG
CCGGCCATCATTAGACCGCCCATGGAGTGCGTCACAATAATCGTGTCAGAAATGGTAGTTCCTTCGCTGGTCTCGCTCAGTCCGAGTGCTAGATCACACA
CTTTCTGCTGCTGCCCGTCGTCGGTCCAAGATATATTGATCGTATCGAGGACTGCAAATTTCGTCGATGTACAGCATGGCGCGTGGTCAACCACATTACC
CCAATATTTCGCGACTGCGAGTATTTTCAAGCCATGAACGAAAAGACACGGACGCGGTGTTGACTTGCACGAACACGAGTCCTCCAACGAGAAATCGAAC
TCAGCTTTCAACTTTCTCACATCTCTACCAGGAGCCATCTTACCCGTAAGCAAAGATCTTCCCATTGGCGATACTGCACTTGGCAACATTGTCGTCGTGC
ACTCTGCTGCTGTGGCACGATTCGGCGCGATAATTTTCACATGGTTGTCTAAGTACTCCACAGTGACATCCATGTCGCTCCCGTACATCGTGAAGCCAGA
CGAGCCCGAGACGCACAATCCAAAATCGAGGCCATTGACGGAAACACGAAACTTTTGTGCACCCAAACAATCGCCAACACCACCGTAGCCCGTTGGTATA
CCCGACACCGCTGTGGCCTCGCTCGACACTGAGACGATCGAGTTAATCGACGGTAGGACCGCCGAATCTACACATTTCGCCGATGGATTGCCGGTTCCAG
GAGAGCTGCGCGACGCGAGCATCACACCATTTATAACGGTGTAGTTGTACAGTGTTGGACCCGCAGCAATGGACGCAAACGAATTGTAACGCACACTAGC
GACTCCACTCGTCTCATTATCGGCAAATACGACAGGGCTGGCGAGCACGGAGAAGGTGGGACACCCGTGAACTTGCATGGCACTGCGCTTGATCGTGAAG
TTAAAGCGTAGCGACGGCCATTCATTCCTTGGTGGCTGAAAGGCGCGAGGCTCCAGTTGCTGCATTGGAGTCGCGGTTTCTTGCCGACTTGCTCCTGCTG
GTATTGCGAGAGCAAACAAAGTTGCAAACAGAATAATCGAGCTTGCAAGTATAAGTGGTGGCATCTTGCGGGTTGGGCGACGGAGGTGAAAATTGAAACT
GACTGCGAACGTGATGGCTCGATTCGATATTTTTCTTGCAATCGTGTCCCAATATGCTTTCGTGCGCGCTTGCAACCACTTCCAGACACATTTTTGTACT
CTGTCACAATTTGACGTCCCCGTGCAGAGATGGGCACCATATTCGAGCGATTCCCCATAGGACTCAGACTTTGGAGGTTCATGTATTGTCATGACCGGCC
GGAATTTCTCATTTATAATACCCTCAGACTTGGTTAAGAATTGCCCCCGGTTTAAACACACTGATTGGAAAGAGCTCTTCATGATGCAACAACAACAACA
ACAACAACAACAACAACAACAACCGACCTCGGAATTGTATTTTCTTCAATCTCTCTTTTAGGCCTTTATTATTTATTATTGAACTTAACCAGTCAGTCAT
GTTCTGTAATCACCATGCCTCCCATGATGATGTTTTCTCTGCTTACGACCTCGGCGGGGTCACGATTGCTTACAGATCAACGGATCCGTTTAAAAATTGC
AATGTACAACGTACCGGCTTTTGCTTTGCGTATGGAACAGGATACTGGTATACCGGTAGCATAATACAGTCAATTCTATACTTCAAGTACTATTATTAAT
GTATTAATATAATATTAATATTGTGCTTTCCAATGGTTTGTCCTTTCCACTTATCGTTTTGGTCGAATTGTAAAGTCTGTAGCTCGATTTAAATGGAGAT
GGTGAAAAAGATAGGACAATTCAACTCGACTAGTTCGCAAGGTTGGATTTAGATATCGAAAGCCTTCGAATTGCAGTTTGAAATCGGCAATTCGGGCCGA
TGTATAATAAATCCATCTTTCCGTCTGACGGCTTATAATGCACGTCGATGCTGATCATGTTCGAACTAGTTCAGATTCCAATAACCTTGTAGCACACAAG
TGCAGCATGTACTCTCAAGACTTTCGGTGTCGAACCATCTTTCTCATTCAGGTGTATGGTATTTGTACGCAGTATTTTATGTTAGTGTCGTGTAGGAACA
CGCCAGAATTATGTCTGCTAGTACTCCCAACCACAAACACACACCTCGCCCGCAAAGACGAGGTGACCCTGCGCACTCCGACTTGTCGGTAGGACAACCA
ATCAATACAGCAGCACTAGCCACGAGCACAGGCTAGTCTGCAACACACACTAAGTCAAACCTCGCTGGTCCTCAGAAGGAAGGGTCCAGGACTTTTCAGC
CGGTAAGCGAGGGGGCCGGAGCAAGGCTCCGGCAGGTAGATAGATAGGAGGCTTCTGTAGCACTCCCAAGTCGAACGAGCTCTCTCGTTCTCTGCAACAC
GCAGCAAATCAATCACACAATCTTTACTCCTTGGACTTGCCGGGCGGGTGAACACTTGAGATATCAGCTCACGAGTCCACCGGCAGGCATAATCCTGGCG
ATCAAGCGGGACCAGACACTACGGACACTTACCGTAGCCGGACTTAACTCTTGTGCGATCGGGAGGAAAATCTGCTCTGTTTGTTGCGCCCTGCGGGCGC
TTATCGCTATACTATGGTTTCCTAATCTCAATACAAATATTTAGTGTGAACTCGTCCGTTGGGAAACTCCTGGATTCCTGACGACTGCTCAGCGAGGTCT
CAGGAGGCGTATCCGGCATATCTTCCGGATGCGACTTCTCTTCAAAGGGCACGACTCGGATATCTTCCCTGACATGACTCTCCTCGTCAGGCCGTAGTGT
GTCGTACATCACCTCGCTCTTGTGCCTTGTCATTCTGCCGCGGGTCTTCTAGGCCAATCAACGCCCTGTCGCACACTTCCCCCAACGGGATTCTGACGAC
CAGACCTCGAAAGCAACGGCGGCAACGGCGACGGCAGCTCCGGTCAATTCACTACACCACATTAGTGATATATTTGGCCCAAATGTGCGACCCTGCGGTG
TTGGTATAACTTTTTTTTAACTAACGGTGTAGTGGAAGACGGAAAGGAAACGAGCCGCTCCTCACGATGGCCGTGCGATGTAGTAGCTCGTGTTCACAAG
TACGTAAAAGGCCATCCCACATTTTACTTAGAGGAACAGCCGGTGACATTTTGATTTTAGTATAGGAACACAGCACTGGCTGGGCTACCTTACTCGAGGC
GGAGCAACTTTTCTCACAGGTGTGCAGCAGCACGCCACGATGCAGGAGCAGCTAGTACACACACAAACGAAGCTAAAGAGCCATCGCACAGCGCAAACAG
AGCAATGCTAAAGCGTTTGCAGAGGGCGATATCTTGGCGTCCTTCAAGGGATTCACCGCCACCGAAGGGATCGTTTTAGGAGGTAAGGAAAAGCAATATA
AAACACGCGTGAGCCTTTTTTCGCATGTTGATGGTCTTGATTTATTTACTGGTCGAGGTCGATCTATGGCATTAAATGGAGCGACAAAAAATCTGCAATG
CATAATGGAGCGATTTCCACAGGCGTTTGGGACGCCTAAAAGTGAGTTTAAGACAGTGTCTCAAACTTTTGGGAAATCGCGGACAACCCACAGCAACTTT
GAAAAGGACCATCACTCTGATTCCCCCACACTCGCAGCGAGAAGCTGGGAGTGGGAGCGCCGTGCTTCTACTCTCGCTCGCTTTAGCCGCATGTTGACGG
TGGTACACGCCACCGTTATGCTGGCTACCCACTGAGGGTGCGATATGCCTTAGTTGATGACCAGCACGGATGCAAACGATGTGCCGTACACATGTCAGTC
ACTGCTGTCGACGTCCATCATCATCCACCCACTGAACGGCGTGACAAGGCGACCAAGAGGGCATGGCGCCTGGTGAAAGGGCGCTGCCTCGTGACAAGGT
TGGAGGATTGCGTATTCGCTGCTAGGATTGCGTGTGGATCACCTCTTCGAGCAGAGGAGCGGAGAGGCCCTCCGAGCAAAGCTGGCAGCTTTAATTTTGT
TAGTTCTTTATATTCCATCACTTTTCATTTGGAAGTCTCAGTCGCAGGTGCGATACAGCACCGAAGGCATGGAGCAGAAGCCGAAGCACCAGCGTGGACC
TAGCTGCTTGGCTAGAGTTGACCTTCACCCACAGCAAAGCTATGGTACAGCTTGGGAGGCATTCTATATGTATGTATAGTGGGGGGAATGATGCAGCCTA
AGCATACCTTCATGCGCAGAGTCTAAGTTACTATCCTGTTCTACGCTCTCTGCAATCGCGCGCGAAGGCTGGACAACTTGGGTCTTCAGAAAAGCGACCA
CGTGCACCGATGAATAGTTTTCCGTGCCAGATAATCTGTCAGCGCGGCTTTGTCGAAGAGTGCGGGACTGATTGTTGCGCGCGCGCAAATGCGGAAGTGA
TTCACCTGAAAATATTTCCAGAGTATTTAGGGGATGGATTTTATCAAAAAATATAAGTTGGGGTAGTCTGGTCGGTCCCAGATCGTTTGGCGGAGCCCCC
CCCCC