Description :
From Genome Similarity Track
Location :
Scaffold_52:174639- 178314
Transcript NameFunction/comments
g18258.t1hypothetical protein
g18259.t1XP_009538190.1 hypothetical protein PHYSODRAFT_566065 [Phytophthora sojae
g18260.t1hypothetical protein
g18261.t1RAW28074.1 hypothetical protein PC110_g15541 [Phytophthora cactorum

Sequence
3675 bases(100 bases per row)
CCACCTCGCCGAGCTTGTCCACCCAGAGGCTGATAAAGTTGGGGTGGCCGAAGCGGTTGCGCAGCACGCGGTTCTTGTTCTTCTGGTCGCTCTCCACGCG
CGTGGGGTATTCCCAGTCCTGCACCTCCAAGTCGCGCACGCCCACAATGCGGAACGGCCGCTCGGCGACGTCCTGCAGACACGAAAAGCGTTAAAAGCGC
TCCTCGACGTTATGATACATCGACTTCAGAGCTTGTTTGACGTACGTCCTCGTCGTGCTCGAAGTGGATGGGGCGCATCGCTGTTTGCGAGGGCTCCACC
TTCTTGGCAAAGGCGCGCGTGGCCTGCGAGCGAGCCAAGACGGCGCGGGAGCGGAGAGCGGCGCGGCGCAGCATGACGACGAGCTATAAGTTGATGTGCG
GTCGGTGAGGCCACTCGTTGTGTCGTGTTTTGCACACCAATTTGATGTTCCCAACACACGTTGACTAAAGTTGCACTACAGTTGCGCAACTTGATTGTGT
ACACGACGGGTACACCAACATTCGCCACTTGTGAGACTAAATGGCGATGGAGGGGGCGGCGCTCAAGCAGCTGCAGGCGACGTGCACGTCCCTGCGGGAG
GAGATGGCGGGGCTGTACGCGCATCGGACGTCGGACGAGGCGCGGCTCAAGCAGCGGCGCTGGCGTGTGCTGCTGCTGCTCGGAGCTATGAAGAGCGGAC
TGCGGGAGACGTTCCTGGAGTCGGACGGCCGCCGAGCGCGCGTGCAGGAGCAAAAGGACGTGGCGGAGGCGCACCAGCTGCAGCTGCAGAACCTACTGTA
CGAGAAGGACCATCTGCTACGCGAGATCGGGCGCTGCAGGGGCTTCAGCACCAAGGAGATGGACAAGATCGAGTTCGCGGACGGAGACGTCCCCATTACG
GTGGACGCGGACGTGCACCGTCAGCACCTGGACCAGCTCACACAGGAGCTTCACGCTAGAAAGAGGTGGGACGTAGGTTTCTATTGGAATGAGCGTTGAA
TTTGAGCTCTAACGGTGCTTTTGGGGTCTTGTAGGCTGCAGACGCAGCTCAAGGAGATCAAGCTCAAGATCGCCAAAGTGGAGGATGCTACGGAGACCAA
ACAAGCATTTTTGAATGCGTTGCCCGACCATTTGGCTGGTATTGAAGCGGCCACGACGGGGCTGCAGAAATACATGGGGGAACCTGTGTCGGCCCAGAGA
GCGAGACATCAGGCGGCGGGAGTGGAGTTGGCCACCCCGTTGTATGCGCTCTATTGTGAGCTGGAGGCGTACCGGACTGCGAGCGGTGAGGCGGGCAAGC
AGTTGGCGTTGGATATCGTGGACGCGGTGGGCGTGAAGCACGTTGGTGCGTTCCGTAAGCGCGGCTTTCCTGCCGCACTGGATCGACAGGAGTCGTCAAC
GGCTGCGGTGAAAAGGCTGAAGGCGCCGTCCCGCTCGCCGTCTGCTAGTGTGAATGGAGCGACACCACTCGGTCGTCCGCCGTCACGTTCACCGTCGGCC
AAGCGTGGAGCAGACAGCACGACTCGGGAGCCAGAGAGCGGGGAGATCGTGGCGACACATACGGCCGAGAAGCTGCTTGAATTGCGCCCGCATGCTTCCC
CATCGGAGGAGGAAGAAACCAAGGAGGAGGGCTTGGAATCCAAGCACTCTCATCACCACGACCAGGATGAAGGCGCTGCATCTGCACAAAACTTGTGGAA
GCCCCACACGAAAGCTCTGCAGCTGACAGTATCTATTCAGACTCCTTTGGATGCCGACAAGAGCGGAGCTGCAGCTACCAGCGTATCCGGAACTTTCACC
CTCATGTTCCAGTACTTTCCTGTGGCCAAGGTGGTCACCGCTGAGGTAGTGAAGACGAACCCCGCTAGCCTTAACCACGGCAGCCACCAGCGGAGTATCC
TGACGAACCTGTTCCCAGGAGACGATGGGCTGACTGTGCCTCACTTGGCTGTGAACTATGCCTACCATGAGGAGGACGAAGAACGTACCGAGGTGGAGTT
CCCAGCGAATGCTGTATGCCGCCCGTACTACTGGGCGCAGTGGATCTGCGGTCTGGACCCCATGAAGCGCCCAGACTCGTCGGATATGGCCATCGACACC
ACTGAGGAGAAGCCTCGTCGCCGACCGGAGCCGTCGGTGCGTAATGTTATGAGCCAGCTTGTGAAGCGTTTTGTGGCCACCGCAGTACTCAAGAAGCACC
TGGACCAGCTGAACAAGTCTACAGGCGCTTCCCATCGATCACAAGACGACGGCGCGCATTTTGTACACCCTCTGGCGCGTCACCTGTACCCCCACGTGGT
GAAGACTCACCTCGAAGAGTGGAAGGAGATCCCGGCACCTCCACAAGACGTTTTCCAGCTTTTCAGGGAAAGTGTGGCTCCGTCAACGCGTCCGCGAGCC
CAGTTCCACCTCCCGACGACAGGCTGCCGCTACTTCCGCTCTGGGTTCAAGAATGGCCAGACGAAGGTGTCTGCTATCGTTGAGATCTCGCCGGAGTACC
CCGTGCGTGCGCCGCGCTTCCTCTTTCAGCCACGATCGTCTTCGAGCAGCAAGGCGGTGGACAAGGACCAACTCCCCGTTTACGAGAACCAGCTGAAGGT
GTGTGTTCCTCTCTCTCTGCTCGAACCAACTTGTGCTTAACCTCCGCTTTGTGTCATGGCTTCGCTCACAGGAACTCGAAATCGAGGTGAACGCATACTA
CGACGAGTTGATCCCCAAGGGTAGCGAGCACTTCCTGCTGCTGCACCAGCTGCGCAAGATCGAGGTGTGCTTCGACGTGCTGTGCAACGCTGCAGCCAAC
AGCGACGCGGACGTGTCTCTGTGCTTCGGTCGCGAGCGTCGCGGCAAAGACCGTCGCCAAGCCATGGTCATGGACACTGCCGCTAAGGAGCTGCGTCACC
GGTAGATTTGAGCCCCACTAACAACAAGGAGACAGAGAGACGGTAAGAAGGAAGGAGGTGTTTTGCATATAGTTTCTATCCACGTTGTGCTCTGCTGCAG
CCCTAGGACGACGTCTGCTTCTTCTTGGTTAGCTGCACCGTCTCGCGCTTGAGCACGTGCAGCAGCGTCTGCGAGCTCTCGAGGATCTTCATGTAGGCGG
CCTCGGTCTCCTGGATGGTGCGGTCGTACTCGTTGCGCGCCTGCGTTTTCCTGGCCAGCGCCTCGTTGATCTTGCTCAGGCGGTCGGTCAGGATGGTCAG
GTCCTTCTGGATCTTGGCCTTCTCCTCCTCCTCCTTGAGCATGGCGCGGTTCACCTCCTCGCGCTTCTCGCGCAGGTCCTCGATGCATTTGACCAGCTCA
TTGTTGTAGTTCTGGAGCGTCGCGCCTTGCTGGGCCATGGTGACAGACGGCAAGAAGCACTACTGGAGCTGCTCACAACCAGGCGCGGATATCCGTTACA
AAAGTTCTGGTTGAAGTATTCCTGGAAAACTGTAGCCATCCTCTACAACTGTGAGTGGTGTAGTCATGGCCTACAACTGTGTACCCATATATGCTGTTAT
AGTGTGTTTCTTGTAAGTTGGCAGTCAAAATGGGCGTGAAAGACCGCATGTTTGCAGGACTCTGTCTGTGCTCCACCGGACTGGAGCTCGACATCAAGGT
GCGCATCTTTTGTGTATGCGTCTCTTCTCTCTGATACACTGCTTCATTATCTCTAACTCGCTGTCTGTGACCCGC