Description :
From Genome Similarity Track
Location :
Scaffold_109:174619- 176199
Sequence
1580 bases(100 bases per row)
ATATGAAGTCGAAGCAATCCTCGACGACAAGCTACCATTATCCACGAGTACGTCCCGGTCACAACGGAAGTTTAAAGTTAAGTGGGTCGGCTACGATGAG
TCTACTTCGGAATTGCTGTCGAATTGGTCATGTAGAGGTCTCCTCTTTGACTATCTACGACAGAAGAAGCGTGAAACCCGTCTGCAAATGGTGCAAGTTG
CAGATGAGGATATACAGTTATTGCTCTAAAGGTTACACCAGCTCAACGGGCGACACAGGCCGAGTTGAGATGGAATGCGACTGTGTCGAAACTACATATA
CTGAATAATTACGAAATGAAGTCCTGAACGATACCTACTAGACGCCCAGTCAAAAGAAGAAAACTAAAAAGTTGGCGATCCGGACTCCAAGTGAGTTGAA
CCCGACGGAGACAGCTGGGAAGAGCTCAGCGGACTCGACGATTGGGGGCGTGGCGTCGTAGCAGACGTCATCCCTTGGGAAACTGCGGAAGGAGATGCCA
CATTCGCAGCCGTGGCAAGAAGTATCATCGCCGAGCTAGCCAACGAAGCTGACGCCGAACCAGGTGCCTCAGGACCCGACTCGGCTGAAGTGGGTTGGGG
CGGATCCGTTCCACTGGGGAGTGGGGTGCCGAACAGAGACATACTCGGAGACGGAGATTGGGAGAGCCCAACCCATCGTCCGCCGAGTCGTCATCAGCCG
AGCTCACCGATTGAAGACCCAGTGAAGATGTGGATGCCTTGACGATTCAGCCGAGTTGGAGCACCCGGGGCATAGGCAGGAGACGCTTGTTCGGCAATAT
CGAAGTCTTCTTCAATCGCGTCGTCAACAACCTGAGGATCCATACCGCGCGGAGGGAAAACCAAGAAGTCCACGTTCCGAGCGCGGAAGCATGTGTTATA
CGGGTGAGCCGCCGGGTCAGTTAGCCACCAAGCTCGCCAGGGCTCGGCTAGATCCACATCGTGAGCACATTGGACCCAGTCTCTCCCGGATGGAACCCAC
GAAGGTTAAAATAAACCTCTGCGTCCACAAGAGGAGCAGGTCCATCGCCGAGCTTCTGAGTGACCGCCGAGTAGAGCTGGTCGTAAACAGCGACAACCAA
GGATCGTAGGGTATCACTACGGCGTTTGCGCTCGCGCTTGTACACCAGCCACAGCTCATACACATCAGCAAGCTGAGCGGGCGTGGCAGCCGGGTTGACG
TCAGGATGGAGACCCAATAACACACTTGACTCGACGATCCAATGACGACGCTCATAGAGAGCAACAAAATAACTGGTCATTTCGCCATCTGTCTTGATGG
GCCTCCCCGCCGAGTCCAAAGGACTGTCGCCACGAAGCTTCACCCACATATCTCCAAGAACTTGCATCAAAGTTCGAGGTCGGGTCTGAGAAGCCAAGCA
CCGCCGAGCTTCCTCCAGTACCGACGGAGAAAAGAAGAAAGGACGCTCAGGGAGCATTCGCCGAAGACGCTGACAAGGATGGCTCGGATCAAAAACGGCC
ATGAAAGCTCGTATGCCGTCAAGAGAACACGGCGTGGGTGTCACGCGACCCTTACCGCCTATGAGCTCCAGCTGCATCCC