Description :
From Genome Similarity Track
Location :
Scaffold_1809:1746- 3218
Sequence
1472 bases(100 bases per row)
GAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAG
TCCCTCGGAGAGGTGGAGCTCTCGGCGGAGCCAACTGGTCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGCTCCTGCAGAGGGATCGACGGG
TTGAGATCCAAGCAATGGAGGTTGGATCCAGGACGGGGAACGATCCCCAGAGTCGGCCTTTAGATAACGCAGGGTCGGTGGAGGAAGGAATGCAGAGGGC
TAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAA
CCAGAACCGTCGGGTTTTAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGC
CAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGA
GGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCT
GCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAAAGCCGATGTAACGGGGTTACATGGTGTGGAGCACACAGGGGTACGAAGTACCCGGAGAGTTAAC
AAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAG
TTAAAGAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCC
CTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGC
TGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGATTGACTATCTCCTCTGCGAGGTTGGAACACCCCGTGTTCGCGAATTTGCCCCCGGCGC
AGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCTGAGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACTGCCAGGCTGGAATC
GTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTATGAGACTG
AAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATAAAGAGAATCTCCTTCTCTGGACCCGTGAG