Description :
From Genome Similarity Track
Location :
Scaffold_350:17454- 22694
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.21Sr protein
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.15Polyribonucleotide nucleotidyltransferase
Pytve_DAOMBR484maker-pve_contig_350-fgenesh-gene-0.9Protein pianissimo A

Sequence
5240 bases(100 bases per row)
CGTGGCCGCTGGTCGTCTGCGCGAGGAGTCAACACACAGTCCACATACACTTACATACTGGCAAGCCGCGCGGCCCAAGCTGACGACCAAAGTGCCCGAA
GGGGGGGGAGCGCGGAGGAGGAAGAGGTCGACTCCACAGAAGGCCACGAAGGGGAGAGGGAGGGAGGAAGGAGAGCGCTGGGATAGTCGCAGCCATCATG
CCTCGAGCCGCGGCGTCCGCGCCGGCCCGGGGAGTGCGCGGTCACTCAACTCACCACGAACGCGAAGCCTGGCGGGTTGCGCGCAATCCAAATGTTGGAC
ACGTGACCGTAGCGGCTGAACTGGTCCTGGATCTCACGCGTGGTCGCGTCGCGCGGGAGGCCGCCGACGTACACGCGGGTGCCCATGCTGGATGGAGGAG
GGACGACGGAGGCGAAGGAGGGAAGGCGGCGGCGCTGACGCTGGCACTGCTGCTGCTTTTTCGGTTGTGGCGCGCGCACCGCCACGAGGAAAGCGATAGG
CAGGCTAGAAGACCAGTACCGAACTGTGTATGTAAACATTAATTTCTTGAACTGTTGTGTATATAATGAGTCACTCGTCATGGTCCTATATCTGCTGGAT
TGTTTCTCCTTCCCATGGTTGGTTTTGCATCAGCCAAGGTCGTCGAATTAGGTAGGGGTCGGGGTTGGGGAGGGGAAGACGGCCACCCGTTCGTTTCGCA
AGCGTCCGATTCGCATGTTTCGTTATTTACGTGATACATACATATCTAACTCTTCAATACCCTCGGTTCAATGACATGACACTCATCCATCACCAAGCAT
CGTCGCCACCACAGACCTGCCATCCTCGGCGCGCATCCCATTTCTGGCGGTCGCCGCCTCCAGTCCGCCTCGCCCTCGCTTCGCCATGCTGTCCGCCGCG
GGCCGCCGGCTGCCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCTGGCCCACCCGCAGCAGGCGCGCGCCTTCCTCGGCCTGCGCGAGCTG
CTCTTCGGCGGCAAGGACAAGCCCGCAGCCGACGAGCCAGCCAAGCCTGCCGTCGCCTCGCAGCCCAAGCCAACTCCAACTTCCAACACTAACAATGCTC
CTAACAATGCTACTGCAACAGCGGCTATTAAGGAAGAGGCGGTAGAGGAGACCATCATCACGGGCAGCCAGGACGAGCTACAGTACTCGGTGGGCAAGTA
CGCGCGGCTTGCGGACGGCGCCGTGCTGGCGTCGCGCGGCAAGACGCTCGTGCTCGCGACGGTCGTGAGCGAGTCTGGCTCGGCGTCGGCGGCGCGCGAC
TACCTGCCGCTCATGGTCGACTACCGCGTCAAGGCGTACGCCGTAGGCCGCATCCCGGACACGGTGCGGCGCCGCGAGTTCACCGGCGGGGACGAGGAGA
TCCTGCAGTCGCGGGTCGTGGACCGCGTGCTGCGGCCGCTGCTGCCGCGCGACTACTTCGACGACACCCAAGTGCTCGCGACCGTGCAGTCGCTGGACCC
GGCCAACGACCCGCTCGTCGTGGCGGTCAACGCGGCCTCGGCGGCGCTCATGGTGTCCGACATCCCGTTCGCGGGTCCCGCGGCCTGCGTGCGGGTCATC
GAGCTCGACGGACAGCTCTTGGTGAACCCGACGGCAGCGCAGCGCGAGGCAGCGACGCTGGACGTTTTGTACGCGGCCACCGAGTCGCGCACGCTCATGA
TCGAGGCCGAGGGGGACGAGATACCCGAGCAGCGCGTGCTCGAGGCGCTCGAGCTGGCGCAGACGCACGTCGTGCCGCTCGTCAAGGCGCAGCAGCAGCT
CGCCAAGAAGCTCGGCAAGCCCAAGCGGACGTACCGACGCGGCGCGCCGTCCGAGGAGGTGATGGCCAAGGCGCGCGAGCTCGGGATGGAGGAGGCGCAG
GCCGTGCTTTCGGGGGCGAGCGGCAACGGCCGCCACGCCAAGACGCTGCGCCAGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGGCACGTG
TTCGGCAAGATCATCTCGGGCCTGCGCGAGGCGTTCGCGGGCCAGCCGCACGCGCAGGAGACGCACTTCCAGCTCGCGGCCCACGACGTGTTCCAGCAGG
CGCTGCGCTCGCGCATCCTATCGCCGCCCGAGGGGAGGCCGCCGCGCTACGACGGCCGCGCGCCGAACACGATCCGCACCATCGCGCTCGAGACGGACGT
GCTCCCGATGGCCCATGGCTCGGCCGTCTTCTCGCGCGGCGACACGCAGGCGCTGTGCGCCGTGACGCTCGGGCCGCTCGACCGCGGGCTGCGCGTGCGC
GGTTCACTCACCGCGAGCGAGGACGCCGAGGCTTCGACTAAGCACGCCATGCTGCACTACGAGTTCCCGCCCTACTGCGTCAACGAGACGGGCAAGATGG
GCGGCGTGAACCGCCGCATGGTCGGCCATGGCGCGCTGGCCGAGAAGGCGCTCGCGCGGGTCGTGCCCTCCATCGACGAGTTCCCGTACACGGTGCGCAT
GACGTCCGAGGTCATGGGCTCGGACGGCTCATCGTCCATGGCCACAGTCTGCGGCGTGTCCATGGCGCTCATGGACGCGGGCGTGCCGATCCGCGCGCCG
GTCGCGGGCATCTCGATGGGTCTCGTGACGGCGGGGGACCCGTTCGACGCGGCCAAGCCCATCGGCTCGGGCGACTTCAGACTGCTCACCGACATCCTGG
GCACCGAGGACCACTACGGCGACATGGACTTCAAGGTGGCCGGCACGGACGCGGGCATCACGGCCATCCAGCTGGACGTCAAGCTGCCCGGCGGCGTGCC
GCTCGAGATCCTCGCGCGCGCCGTGCACTTCGCCAAGAAGGCGCGCGCCAACCTGCTGCGCNNNNNNNNNNAGCGGCGCCATCGCCGCGCCGCGAGCACA
GCTCAAGGCCGAGCTGCTCGGCGAGCAGCACGTCTCGCTCGAGTTTGTCATCCCGACGACGTCCATCGGCGCGCTCATCGGCACGGGCGGCGCCAACGTG
CGCGAGATCGAGCAGAGCTTCGACTGCGCCGTGCACATCGACCGCCACTCGGGCGTCATCCNNNNNNNNNNCGTCGCGCCGCGCGAGCGCGCCGAGAGCG
CCAAGCAGCACATCCTCACGCAGCTCGGCCACGAGAGCATCTTCCGCAAGGGCGAGCGCTACACGATGCGTGTGACCGAGCTGCTCGACTTTGGCGCGCT
GCTCGAGGCCCCCGCCACCAAGAGCCGCGGCTTCGTGCACATCTCGGAGCTCTCGCCCGAGCGCGTCGTCGACATCCGCGAGGCGCTCACCGTCGGCCAG
GAGCTCGAGTTCGAGTGCCTCCAGGACGGCGTCTCGGGCAAAATGTCCCGCAAGGCCGTGCTCACAACCGGCGGCGCCAGCGACGCCAAGCCCATCGTCG
AAGCCACCAGCACTGCCACCACTGCCAATGCGGCCGACTCGACCGAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCAAACGCCGAGGCAAGGCGGCCGTGTCCACTGCCAAGAGCATGGCCTCGCGCCACGCGGGCCACCGGCGCGCGAGCAAGGGCGGCGCGGCCAG
CGCTGACGCCGCCAATTGACGCGCGACACCTCCTAGCCACAGCAAGTGATTAATAGAAGCCAGCACCGCAGCACACGCAACGCCACTCGCCGTTCATATC
GTTGACTGGATACCCTTGCACACAGCCACACGCCACAGACCCGTCGGCGTCCACTACAAACCTGTATAACTCGTGCGTGCCATCCAGATCAGATGACAGC
CTCCGGCGCGCCGACGACGATCGTCTTCTCCGAGAACGGCACGCGCTTGCGGTTGCGCTTGAGCAGTACCGTGCGGTCGATCGGGTCGTTCAGACCCGCT
CCATTCACCCGCAGCGACATGCGGCCGTCGGCGATGCTGCCGCTGCCAACCGGGCCGTTCGCCGATGACGCGCGCATGAGGAACGGCGAGGATCCCGGCG
CACCCATCGGGTTCATCGCGCTAGACAGCCGCGCACCGCTGTTCTGCATCGCCGACGACAGCGACTGCACCGAGCTCGTAAACGAAGGGATGGAAGGCGA
CGACCGGCGACGGAGCAGCTCGCGCGGGTTCGGCACGCGCAAGCCAGACGCGGTCTTGACCTCATCGTTGCTTGTGCGCAGCGCGTCCAGCACCTCGTCT
GTCAACGGCGCCTTGTCGAACGCGCTGAGCAGGAACTGCCGGAACGCCAGCCGATAAGTGTACTTCTCGAGCAGCGCGTGCACGTACAGCAGCAGCAGCG
GTTCGTCAAAGAGCGGCGACTTCAACGACCGCATCTTGCTCAGCGACGAATGGGCCTCCTTCTGCGTGATGTGGTTGCTCAGGTCGGCGACGTACCGAAG
CACCTCACGCCATTCCGGCGGCACTTTTACCAGCAGCGGCTGAAGCAACGAGTGAGGCGTCTGCGTGAGGGGAATGAGAGGCGCTCCGCCGATCGAGGGG
CTTTCCTGCTGCATACCCTCGATTGCAATCGAAGTCCCCGTCACTGACGCGGCTGGCCACACAAACAGCGAGTTGCAGTTTTGCGGGACAGCGATCGACA
CGCGCGAGTCGTGCGGAGCGTCCCAACCAAGGCGCAGCAGGTTCCTGCGTCCCTGAGCAGACCGCGCGACCAGTCCGAGGACAAAGAAGCAAGTGCCACG
GATCGAGACGAGTGGAGAGTCGGTCGCGAGCTTGACGATCACGTCCAGCACGTCCGTCGCGTAGTGCTGAATCAGCTCGTAGCCGCGTGCTGTAGCAGCG
ACATGGCCCAACGCCCACAGAGCCGCGCGCTTCTCCAGTGGCACGCTCGCAGCATCCCGGAGGCAAGCGATGTACTCGGGGATATGGCCCGAGCTGTGCA
GGATTTGGCAACCATAGCTCGTCTTGGCCAGCTCGCCGTACAAATGCGGCGGGAGACCAACAGAGCGTGGCCGGAGGGGCAACAGCTGCAGCGTGAACTC
GACCGATTTGAGCAGCAGCCGCTTGACAGAACCTGTGCCGTTGTCCATCTCAACGCGGAAGTTCCACACGGCGCGCTCTCCTGGCGCACACAGAGAACAA
TCGGGCGTCGACAGGTACTGTGGCGACCGCTGTTCAGGCTGGCAGGAGCTCCAGTCCTTGTTTTCATCGCTCACGGCATCGGATGGTCCTGCTACTGACG
TGTCAGCAAAGTCGAGGTTTGTCTCGGACGAACGATCGCC