Description :
From Genome Similarity Track
Location :
Scaffold_98:17454- 18570
Sequence
1116 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAACGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCC
ACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATC
CCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAA
AGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATC
CCGCTACACCACAATGGTGCGCGTACCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAA
GAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGG
TGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAA
ACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCTAAGCCCGCTAGTCGAAGAAACAAGAAAG
AAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCG
AGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGT
GAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAG
GATATCTTCGAGCTAG