Description :
From Genome Similarity Track
Location :
Scaffold_71:174538- 175606
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_22288Hypothetical protein
Sappa_CBS223.65SPRG_11888PP-loop superfamily ATP-utilizing enzyme

Sequence
1068 bases(100 bases per row)
CGGTGCCAGAAGTTTCGCTTCCTGCAGCCGCGCTCGACGCCCCGCGACTTACAGCGATGTGCTCAAAGCCATGCTCCAAGCAGCAGTCGTTCATGTTCTC
GAGCACCATGTCGGGCGACGCGCGGTTGGCGACGGCGACCAGCACCTCGAGGCCATGCTCTCGCGACGCAATGGCCTCCATGACCGACTGCGCATGGCTC
CACGAGGCCTTCTGCGTCGCGTCCCACACAAGCAGCAGGCCTTCGTACGGCGAAAGGTCCTCTGGTACGTCGTGCGCCGCTTCGGGCACGTGGAACGCGA
TCGGCGCCGAGTAGTACTTGGTCACGAGCGTGTGCGCAAGCACGGCGTGGTCATCGGCCTTGGCCCACTCGGCAGCATCCTGCGCTCCGCCTGCGGCGAC
GACGGCCTCGACGATATGCTTCTTGCCCACTTGGGCGCTGCCAAGCACGAGGACGCGGCTCATGCTGGTCGAAATCTGGAAGCTGCTGGCAGGGCGAAGC
CTCCGAGACTTTATATATTCACGAGTTTTTCACACTCTTTATTTCACCGTGTTTGATTGGTGGTAAATACGTGCGGTCGGCTGTTGCAAGCAGCCACCAG
AATCGATCCGCCCAGAAGGGGTTGAGCTATCGAGCAACTGATCCTAGGCGCGGTGTTTGTGGCTGGCGTGATATGCTCTCGAAACGCACAAGCGTGCTGC
GAAGGTACCAGTATGTGACACCACCATAAAAAACCTTCCAAAGTGAATATACCACCGACGCCACACGCCCCCATCCGGATATGCAGGATCATATCCGGAC
TTCGCGATGCGATCTGCCGTGTCCTGGACAGGCGGGAAGGACTGCGCGATGGCGCTGTACGAGGCCAAGGCTGGCGGCCACGACGTTGCGCTTCTCGTGA
CCTTCGCGCCAGAGAACCCGAGCTTCCGCGCCCACCCGATCCCGCTCATGGAGGCGCAGGCGGCGGCCATCGGGCTGCGCCATATCTTCCTCACGATCCG
CCCGCCCGACTACAATGGCAGCTACGAGGCCGCGCTGCGACGCCTGCAGAACGACCATGGCATCGAGT