Description :
From Genome Similarity Track
Location :
Scaffold_30:17447- 22674
Transcript NameFunction/comments
Physo_134094Quinone oxidoreductase
Physo_134095hypothetical protein
Physo_134096hypothetical protein

Sequence
5227 bases(100 bases per row)
TGAACCGAAAAATTTATGCAATGCATGTAACAGCCATTTCGAATGTACAGAATGAAATAAATCCATCAGAAATGCAATGTAGCTGTCGAGAATGCAATTT
ATCCCCACTAAATGGAAAGTAGCCGGTGAGAGAAAGAAAAAAAAGTTTTTTCATCACGGGCTTGACCTTCCCATCCTCGATGCGCTCCGTGATCGCATTC
AGAGAAGCCTTGTTGTTGGGGCTAATGAAGCCAACGTGCTGCGCCCCGAACTCCGAGTCCTTAACAGGCTGTGCCATTGGCAGGATCGTGATGAAACGGC
CCGTGTTCTTCTTGAGCACCACCTATGCCCCGTCGTTCCAAGCCGAGGGCTCCACCCAGCAATCGAAAACCGCATCAACAGAGTGCGGCGGCAACACGTC
CACCCACTTCTCCTCGGTGTAGTCGACGACTTGATCAGCGCCGAGAGACTTGATGAGCTCAACGTTACGTGAACTCGTCGTCGCGATGACCCGAGCCCCG
ATGTCGTGCTGAATGACAAACATCCCGACTGAGCTGCTGCCGCCCAATACGAGGATAGTGTCTCCTCGTTGAAGCTTAGCGTGCTCCGTCACCCCGGCAT
ACGCTGTAATCGCCACCGAGGGCACCGCAGCGGCCTCGTTGAAGTTCAGATTCTTGGGCTTCGCCGCTGCGACGTCCTCGTCCAAGACCCAGTATTCCGA
CAGGCTACCGATGGTGGCACCCGTCGCGGACGCATAGACTGCGTCGCCCACCTTGAACCGCTTGACGTCGCTGCCGACCTCGACCACTTCACCGGCGGCG
TCATGGCCGATGGCGAAGGGCTGCTCAGGGGACGGAGCTCGGCCCAGCATCATTTGGCCCATGACTTCCACCAGCTTGTAGTCCAGAGGGTTCACCGAAG
CGCTGTGCACCTTGACGCGGACTTGGTTCGAAGCGAGGGCCTTCTGCGGCAGGTCGGAGCGGAGCTTGAGCTCGTCCTCGATCGGGCCGTAGTGGTCGTA
CTGGTACGCGCGGTAGGTCTGCGGGAAAACCATGGGGAGGAGTGGAGTTTGTACTGAAGTGCTTGTCGGCTTGAAGGCGAATTGCAAAGTGAGAAGACGA
GTCTCCGAACTCCTGAAAGCAGCAAGACAAGGTGCTCGGGCCCAATCCGATTAGCTAGACGTGATGACCAGGGTTCGGTAGTAGTCTCCAGAATAGTAGC
GATAGTAGTACTAATATCACTACTATTACTATAGTAGTGCTATAGCAGTGGGGTCTGGGCCTCATAGTAGTGATAAAACTATAGTAGCGAGAAAAGAGGT
CACTAGTAATGATAATAATTGTGCTAATATCACTACTAATTCCCCGAACTTCAACCCACGTAAGATCTTCAAAAGGCGCGCAAATTGGTGGTTCTCCGAC
CCCCCCCCCCCCCCGCGCTTCGAGCTCTTTCGCTCATTTCTCGATTCTCAGGTAAAGCCAGACTGATGAAGTGTGCTAATATAGACTGACATTGGGGGAA
TCTAGAGGAGACTTCGCCGTGCAGTGTGTGTGGTCGGCCCGTGCATCACTTGTGCAGCAATGAACTCTGCACCAAGCCCGACGTCGACCTCGCGAAAAGG
TAGCGCTACCATTAGTGGTCTTTGCACATAACTTTTGCTTACTGATGCTCTACATGCAGGTTCTGCAGCCACGCTTGCGTGAGCAGGTTCTTCAATACGG
ACAGCGACTCCCAGGAGTTCACGCCAAGCAGCCAATCCGGCATATCGTGTTCCAGCAACGCCACTGTGATCGACCTCGCCCAACATGACGCCGAAGAAAA
AGAAGAGCCCGTTAACAGTATCCCCGATCATGTCGTCTACAAGCCGCCAGCAAACTCGACCGACCCGGTGTGGGAGCTGATCCACCGCTTGGATACACCT
TCCATCTACGAGGCCAAGACGTACACGCATATTTGTCTGCTTTGCGTGCAGACGAAGACGTGGCAGGACTCACTCTGCCGCGCTGGCAACGCATCGAACG
CTAAGACCCATCTAGTGTCCATTCATAAGGACCATGAGTTGGCTATCCAAGAGCAGCGGCGCCGGCTAACCCGTGCAGACCGCTACATGGTGCAGGTGGG
GCCCAAAAATGAAACCAAGCGGGAAGTTTCTCCAAAAGCAAGATCACAAGCAGATCACCCCCTAAAGCGCCAGAAAACGTTGTGGTCAACTTCGGGGAGC
AGATAACGGGCCATATAGCACGGTGGCTGATTCATGATGGTGCGTTTTTAAAAACTTTTATGACTTTGAAAGCTGCTAAATCTCATTATTGCTATGTGTA
TCTGTGCCTAGGGCATGCGCACAACATGGTGACGACTGCTGCTTTTCATGAAATGCTCGTCGGCATTACGGGCAACCCGAATGTCACTGTACCCCCCACC
AAGATGTATAACGACATTTTGGACAACCATTTCGAGAAGTTTACAGCGGACGCAGCTGAGATGTTCATCGAAGAGTTTCAAGAGCTGGATGAAACGTCAT
GACGGTGGAGCACGACCTATGGACAAACAGCGCAAAGAATAACATTGTTGGAGTTCAGGCAGTTATATCAACCACCAGTGGCGACCTGTACGCCTTGCTC
TCCTTGCTCACGTGAAGAACGATGGACATGATTCCAAAGAAGTGGGCAAACTGATGAATAATCAACTGAAGACACGCTACGGTCTGGATGTGAACAAAAT
GGCTCGCTTCACGATATCGGACACTGCTCCAGGCGCGCGAAAAATATCGAGGCAATTCGACTCGACCCTGCAGACGGACTGTGCGATGCACGCACTCAAT
CTCTGTATTGGCTATGGCATCGGGTTGAAGGAGAATGTGCGCAACGAGTACAAGAAAGACCCAAAGTCGGAGGCGTACGTCAAGACGCGGACTGTTGTGA
CAAAAGGTGGGGCATTCCCAGAAGGTGGCAAGGTGATTCGAAAACTACGTGCTCTAAACAACTTCTTTGCTTCGAGCAAGTCCCCGGAGCGTGTCGCCCG
CCTCAAGGACGTCCAAAAATTTCACAAGCTACCCCAGCTAGCAGCTTTGGTGGACATCGACGTTCGCGTGGCGTCCACGATTAAGTTGTTTCAGCGTTTG
ATCATCAACTTTTCTGCGTTCCAGGCATTTTTCCTGAGCGCAAACGTGGCCAAGGACGAGAAGCATGTCTTCAACCGAATCACCGACGCAGAATGGGCGT
TAGTGATTCAAATGGAGGCGATCATGCAGCGCGTGGCAGAGTTAGCACTCGTGGAGGCTCAGTCGGCGTCCATGCTTTCTTCGACTATGTATGTGCTGCT
GCGTGTGGCTTCCGCTCGCATGAACTCGTACAAGTTCTCAGCCTACTGTCTAAATGGTGCTCGTGACACGGGGACGAATGAGAAAAACTTCCCGCGGGTC
CAGCTAACGTTGCCCGATTTATCGGAGCTCGCTCAGCGATGCATCACGCGAACGCTTCACCAAATTGCTGAGCGTCTCCCACAGCCGTCCGTGCCTATGG
GTGTGGCCTTGCTACTCGATCCACGCACGAAGTCATCTGCCAAACAATTCCTTCGCATTCCTGACACAGCGGAGGCTGCCACAGACAAGATATTGGAGGA
TGCGAAGGAGCTAATGCGCGTCGAGCACCGGGTTTTCTTCAAGGGTCTGCATGCACGTGACAAGGAAAACGTCCACGACGCAGCGTCTGCATCAAACTCC
CCACCAAGAGAGGCTAACAGTGGTTCAGACACTGAGGCTGACTTGCTGTATGGTGAAGAGGTATCTCAGCCGTCTGAGGAGGCCAGTGCTGATGCCATGA
TCAACTCCAAGGCGGATGCGTTGCTAGACCAGTGGTTTGACCTTCGAGTCGATTGGGCTGAGGTGGCTAAAAGGCAGTATCCCGCCGAAGACGAGTACGA
TACCGTGCTGGCTAAGCTGAGCGTGCGCGACAAAAAACGAGGTGTTCGTGTGTGGAATGTTGAGCAAGTATGCAACAACATTGACGTCTGCAGCTGGTTT
CTCGAGGCTGGGCAGAAGGAGTTCCCGTCAGTTGCAAAACTGGCACGCGTCTGGCTGGGACGGGGCTGCTCAACTGCGTTCCAAGAACGCGTGTTCTCTA
CAGGCTCCTTTGTGATGAGTCCACCAAGAACGCGGACTGCCAACGAGCGAGCACAAAGGCAGCTGATACTGCGCCACAATCGTCTCGAGCTCGCGCGCAT
GGAGGAAAGTAAGCGGCAGATCTGGTAAGCTCCGACAGTCTGGATAGTAGTGCTATAGTAGTGATATTAGTAGTGATAACTACTAATTTCGTTTCTTCAC
TACTAGTAGTAGTAGTAGTGATAGTGACTCACAGTCGAATAATAGTAGTAGTATCACTACTAGCCAGAATTCTCACTACTACCAAACCCTGGTGATGACG
TACAGCGAAGTTTGGCAAGTTGGGACGATCAGTCAGTGTGGAAATGTAGCCATTTTCTCGAAGTGCTGGAGGGATGTGGCGGACAAGCTAGGCAGCTACA
TGAAGGACCTTCACTACAAGGCAGCTTCTCATTTGTGTGGCACAGACTGTGCCACAACACAGATACCGGTGCCCGCACTTTCAACAGCGTCCATGGCACG
TGCATGTGCGTCGTGTTCAACGACCAGCTGGACACGCTCGACACGCTGGCCCACTTCCAGTTCCGACAGAGACCATAGGCGAAGTGTGAGGTGGCGGGCA
CGGCCATGGTGGTGTGCTCTGAGGTCTAAGGGAGCACTAGTCGCACCTGGACGCTGCTGCCGCCTCTATTTCAAACTGCGCAGCGAAGACGTATTCCTTC
CCCCCGCTGCGGCGACGCGGCCTGTAACATTCCGCGCTTCATCTGTGCGGGCTCACTATCGGTCTACAGTGAGCCGCGTAGTGCAGTTGTAGTTTGTATT
CGGGTTGCAGCGAGCATTGCCTCCTCGCCAACAAGAGGCGCCAGGGGCCATGAAGTGTAGCCATTCCTGGAGGGATCCGCCTGATTTACTTCAACTTGCC
AACACAGCCAGCCAATCAGCGATCAGAACGCCATCTTGGGGTATCCGAGTAGTACGTAGGCGCGCCTTCTCTTTCAACACCCCCAAACAACGGAATCGCA
CACACAAGTGCAAGAATGGTGAAGCTTGCAAGACGCCGCGCAATGCCGCACCGCCACGTGCCGGAGCCCAAGGAGCCCTCGCCCTTCTTTGAGCGCCTGC
GCTCGGAGCTCAAGTTCAAGGCGCGGC