Description :
From Genome Similarity Track
Location :
Scaffold_184:174463- 178692
Transcript NameFunction/comments
Phyin_T30-4PITG_20405Serine/threonine protein kinase

Sequence
4229 bases(100 bases per row)
AGCCGGAAGCTCATTGAGAGAGCAGAGCAGCATGTAGAGAGAAGAACACACGTGTGTGTCATTCTGACATTTTGCTATTGCATGCATAGCATCCAGGTAT
CCATCAAATGAAATTGTGGCGAACATCCAGCACTAGTCTGCATTAGAAAAATGAACTAACTTGTTATCGCTAAATGCACATGCACAGATATCTATAGCGC
ACGCAGATACTAAATCTCCTTTTTACTCAGCAAACTAAGACATTCGGCGCCACAAAATATCTCGAAGGCTACTAGCATGTAAATCCCACAGTTGTAGTTA
TCGACTTGCACTCCGAGATCACTTTGGTAGGCACGGGTTCGATATTTTCTTGGGACGAAATCAGGTAGCATCGCCACCAACTTCTCGGCAAGTGGTCGAA
TATTGGCCCCGCAGGTGGAATTCATCGGGTCGTAGAACTGAACCCGTAGTCGGACGATGCGATTTCTTCTCGCAAATATTTAAGAACGTGGAACTGGTAG
AGCAAAATAGCAACGTTGGGGAAGGCCTTCTTCAACACTGACATCTCGGTGAGGTCCTTGTCAATAAGGATACACTGCAACTTTGTCCTTGCAGGGTTGT
TAGCCTTAAATTCCTCCAGCGCTGTTAGCAACGTCGGCCATCGCTCGTTCTGTAGCAGAGAGTGCTGCACAAATTGACCTTTCCCGAACGTATCGTGGGC
CATGAAGGAGAAGACCTTGTACTTCGAGCGATTTCGCGTCAATCAGAAGGACTTCTGGAAATTGTTTGAAGAGAGACCGCATGTGTTTCGTTTGAAGAGT
AATGCACGTAGCAATTTTCTACCATGACAATTGCACAATTTTTAGACAATAGTTAAAACCAATTATAAATGTAATAGTACCTTTCCATCCATTTCATCAA
CGAATATACGACCGACATTCCCGGGCCGGTAACCAAACTCTGACATCCACGTCTTCATCCGTTTTGCGCTAGAAGTTGGTCCCTTTCCGTTTTCACGATC
CTTCAATTTCCGAACTAGATTTTGAACGTCCTGAGCACTTGGATTGCTGTCCGACTTTTCCTTAATAAATTTAAAAATACTCGTCTTCTTAGCGCCCGCC
TTTCGGAGTTCACCGACGGTTTGCAAGGTTTTGTTGGGGATGGAAACGCGAGTAGAGGAGTGCCCCGGGAATACATATTCAGATAGCCTGTGGTGATGCT
TCTAGATGTCAACGAATCTAACATGCCAGGCTTTAATAGCAAACTGAGGCATCCGAATGTGGTCAACTTGATCGGAGCATGCTTAGAGCCGCCCAATCTG
TGCATGGTGATGGAACTCTGCGACTTTTCGCTTCATCACTTGCTCCACGGAACCAATACGTACTTGAGCTCCCAACAAATGACTCGTATCGCCGTGAGTC
AACTCAAATTACCTGCAATTTTTGCCGGATTATTATTATATTTACAATCGCTGGAAGGGAGAGATTGCAGACGGTATGCGCTTCTTGCACTCTAGGAGAC
CTGCGGTTATCCATCGGTACATTTGTCTTGTTTTTCATGCATACACTTTCTTTCGAAATGAAGACTACCTTTTCTGTCAATTGCGTAGTGACCTGAAAAG
TGCCAACGTCCTGCTTGACCAAAAAGGTGTAGCCAAGCTCTGCGATTTTGGTCTCGTACGGTGAGTTTCTTCCGTATTGTTCACGCTTGTACACAACTCA
ACGCTGTTGAGTAGCACAAAATTCACGACGGCAGGGACGCCCAGCTACATGCCGCCTGAACTGCTGAGCGGACAACCGTTCTCCAAAGCTGTGGATGTCT
TCATGTTCGGAATTCTTCTATGGGAGGTGAGAAACATCACTAGTGACTTGGCGCCTAGCTGCTCTAATGTGTCCACGCTGATAGATTTTCAGCCGCGATA
TTCCGTTTCGAGGCTACGATGTCTCCGATATTAAGAGACGTGTCCTCGCAGGAGAGCGCTTCCGCGTTCCGACAGTGGATTGCCCGCGCGAGTGTCAGGT
AACAAATACCTTCCGGTACTTGATGCTCCCATTGCCTTCTCTGGATAATTAGTTTGTTTGTTGCAGGAATTAATGAAGCGATGTTGGGACGGCGAGCCAA
GTTGCCGTCCAACATTTGATGAGGTGTGCCAAGTGCTGCGGAATGTTTCCTTTGCAAGATCTTTCGAGGCCTCTCAAAGTGTCTTTGAAGGCGACGCGCT
CGACTGTCTACTTAACGCGAAGTAGCAGAGACAGTATCACTTGATTTTTTTCGTTCTGCTAGCTAAGTGAAGCTACTCCATCTTACGCAGAGTCTTTGGC
CCACTGGTCGAGTCCAAGGTCGTTCCAGCGATCCACTCCGGCTCTCGATGCTCGTCAGCTCTGGTGTACTGGATGGATGAATGCGCCGCATCAGCATCCG
TACAACACCACGTACTTCTCGTTCCAGTGTAATCTGGAGGTCTTCAATACCTCGTGGTACGCATTTCGTGGATCTGTACTGGAGCGATCCGGCTCTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCAGAACCTAGAAGTCCGAA
CCCACGCCTCGCTCTGTACAAAATCGCCGAGTTCGAAGGAAAGCGCTACCGCTCTGACGCGTCGCTCCAGTATCTCAAGCGTTTCATCTACGAGATAAAG
AGCACCAGGATGCCCCAAAGTGCCTGGTGCGAACCTTTCTCGCTATGCTTGGGACGCGCGGCGAAGAGTTGGTACAGGCAGCTGCCGAAGAAGACTCAGC
GACGTTGGAAACTACTCAGCGAGGCGTTCCTGGATTATTATTGCTCACAGTTCGACCAATCCGCCCGCACTCGTTACTACTCGGCGAGACGTAAAGTCAA
TGAACCGATCTGCGACTTCCTGATCCGAC