Description :
From Genome Similarity Track
Location :
Scaffold_344:17446- 19726
Sequence
2280 bases(100 bases per row)
TAGAGTCGCCATCGATGGCGCAAGTTATAGTCGCATTTGATAAAAGGCGGATGTGCAGTAGCAGGCACGGGGGATGAGTCACCATGCTCATTCTCCGAAC
TAAACAGACTGTGGTAGTGATCATGAGTCTGACCACCTGATCGAGTCCTATTCGAAGGCTCATACTCGGCCGCTCCAGTAGACTCGGGCGACCTAGGTGT
CTTCTTCGAGTTGGACCCACCCTCCGACTTCCGAGATTAGATGAGCTCCACTTGAGAGCCATCATCAGTAGCACGTGGTGACTCACTACGTGCATCTGCA
GCAACTGTTGCCGCCGGAAGAGTTGAAGAAGTAGCAGACAAAACATCTCCTGCCGCACGAGGCTGTGAACTTTCACGAACAGCTTCTTTCTCAGCAGATA
TCGCCGCACATCGCATGAGTTTCTTTGCCATGCAATGAAAAGTCAGAAATGTGTGGATCTGACCGAACAAGTGCTCCCTGTCGCTGATGAAGTCTAACGG
TGACCACATCAAACATGATAGTTATTGATCAACTATCATGTTTGATGAGTCTGTTACATTTGATTAACTCTCAATACTTGTTAATTAGAATATTATCATG
AAGGCTTATAATGTTCGTGAATGTTACCATACGGGGTAATATTCAGAAGCACTCACCTATTGGCTGATATGGGCCATCATGTCAGTCAGCTCTAGCGGTG
CAATCAGTGATGAGCGTGCGCAATGAGTTGTGAGCAAGAGTTCAGCATACATTTTGGTAGACACATATAATTAAGATAAGACTAAAACATAGGATAATAA
CTAGGACTTAATTATATTTAATACAGTTTTACTTTCTACTTCTATTGACCCCGTAGTTCAATAGCTAGCCTTCCTCTGCACGTACGGTGTACGTGAAGCT
ACATGCGGCACTTACTTACACGTTGCCAGTGTAAGTTGACTTGTACTGTGTCGGTGCAAGTCACCACTGCCCCGTCACATTCCCGATCCTAAAGTCGTGC
GGAGATAATAGTGCGGCGAATCTGACTCGGATTGTTTTCCCGGCTAATAATCTATATTTTATACTAAGGCGTTGCAGTAATGCCAACACTTTGCGGTGAT
GTTGCGAAGTTTGCCTCCAAGCTACGAGAGCTTGGTTCAGGCATTTCGCATGTCGATTACAAGCTTCAACTTCAGTGACCTCGTGAACAAGTTAATTGCT
GAGGAAGTGCGCCAGAAGGAGGCAGCACGGGTAGGAGAAGCAACGGCTCTCTACACAGGCAAGAAGAAGGGCAAGCAGCAACCGAAGATGCAGCCAGGAA
GGCGTACGAAAGGACCTGCTGGAGCGTGCTACAATTGTGGCAAGGTAGGCCACTACGCAAGAGATTGTCGATCAAGTCGTGGATCAAGCCAAGCAGCGCA
TGACCAGTCAAACGTCGCGTTTAACGTCAGTGAAGGCTTTGTAAGCGACTGCTGGGTCATGGACAGCGGCGCATCGGCACATATGTGCAACGACCGTGAT
GCCTTTGAGGATTACGAGGAAGCGCAAAATGAGCGAAGTGTATCAAGCGCGAAGAATGACGTCAAGCTACAAGTTATCGGTCAAGGGACGGTAAAGCTGC
GCGTTTGGACCGGGTATGCATGGATCGATGCTCGACTTGAGAACACGCTTCATGTTCAAGATTTGACGAAGAATCTGTTCTCGCTTACGGCAGCAGCAGC
GCGAGGAATGACTGTGGAGATTACTTGCAACGAGTGCGTGGTAAGGCGTGGTGGCACACCGGTCGCCACCGGAAGGAAGCAGGGTTTCCTGATATACCTG
AATATTGAGGTACATGCAGAGTAACATGTAGCAGAAAATGAAGGTGAGCTATGGCATAGAAGACTGGGTCACGCGTCGTACGGCACGGTTAATGCTATGA
TCAAAGACGGAAGGATCAAGGGCGTGAAGATGAAGACGGACGTTGTCTGTGACGTATGTGCAACGTCAAAGCAAGTGCGCAAGTCGTTCACGACATCCGA
GGAAGATGCAGAGCTCAGGGAGGTTGCGCGTTCTGACGAGATGGTGTGCTCGGACGTTCTTGGACCTATAACACCAACGTCAAGATCTGGTTTCAAGTAT
ATTGTGAGTTTCATCATGATGAAGAGCCGGTACGTGACGGTCTTCCCAATGCGAAAGAAAAGCGAGGTTACCAGCGCGTTTGCAAGGTTCTACCAAGAGA
TCAAGACGTTGACGGGGAAGAAGATCAAAGTGCTCCGAAGTGACAACGGTGGGGAGTACCGAAACGCTGCGATGGATAAG