Description :
From Genome Similarity Track
Location :
Scaffold_76:17441- 19419
Transcript NameFunction/comments
Phymu_g3564hypothetical protein PHYSODRAFT_313705

Sequence
1978 bases(100 bases per row)
GACGCTAATGGCTACGTCAAGACACGGACGTACCTTAAGGGCAAGTTCCTGGGCAAGGTACGAGTTGCAAGATGGGATGAAAGATGGTAGTGCTGGTGTT
AATGGTTTTtatgtgtgtgtgtttaTAGGGCGGTTTTGCTAGATGTTACGAGCTGAAGTGTGAACAAACCGGCAAAGTTTATGCGGGCAAAGTGGTGGCC
AAGAGCTCGTTGGTGAAGCCCAAGGCAAAGCAAAAAGTGAGAGCAGTTGACGACAGTGAGATGGTTGTGAGAGAGCGCTGGTTTTAATGTTTTTTTGTGG
TTGTTGTACTTTCTCGGATTTCTTTTAGTTTACGTCGGAGATCAAGATCCACAAATCCTTGCACCACCCGCAAGTCGTGCAGTTTGAGCACTTCTTCGAA
GACTCGGACAACGCGTACATTCTGTTGGAGCTCTGTCGCAACCAGTCGTTGTCGGATTTGAtgcggaggaggaagcggttGTCCGAGAGCGAGGTGAGGT
TCTTCATGAGGCAGCTTGTGGACGGATTGGCGTATCTGCACGAGAGCTTGGTGATCCATCGCGACCTGAAGTTGGGCAACCTCTTCCTCACAGACGACAT
GCGGCTAAAAATTGGAGATTTCGGACTCGCGACTCGTCTTGACAACCCGGACGACCGCAAACGCACAATGTGCGGCACGCCCAACTACATTGCGCCTGAG
ATTTTGAGTGGGCAGCGTGGAGACGGACACAGCTTTGAAGTTGACATTTGGTCTACGGGAGTTGTCATGTACACGCTGCTCGTGGGACGGCCACCTTTCG
AAACGGACGACGTGAAAGCCACCTATAAGCGTATCCGTGCCAACCAGTACGACTTCCCGGAGGACGCACGCGTTTCTCGGTCCGCTCAGTCCCTTGTTCG
TGGTATTTTGCGCAGTGACCCGGGTGCACGACCGTCGTTGGAGCAGATTTTAAAGCACCCGTTTTTGGCAGAAGAATTCGTGCCGACGACACTGCCCCGA
ACCGCTCTTCTGGTTACGCCTCCTTCCTGCAAACCTCAGTCATTCGCTAGTCGTCACAGTGACAGCGAGCGCTTTGCGAAATCAACAGGAGTAACAGTTC
CGCCGCCGCCTGCCGCCTCAAAGCGATATCCTCTTCGAGCACGAGATGAGAACGCCCACGCTCACCGCGCTTCTGACCCGGGAACATCTCCTTCTCTGGC
GCAGACGTTGCCTCCTGCCTATAATCGTGACGGGTCTGGGAAAAATTCCAGCACCCGCCGGAGGATCAacacgacagcagcggaCACCTCGGCTCCATCA
GCTAAtgttcttgaagcagcaTACAAGTCGCTTTCCCGGTTCTTTTACCTCCAAGAGCACAGTCGTAGTggccgtggtggtgaacaGAGGTTGagcgcgt
cttcttctgctgctaGTATCGTTGCTGAGGCTCAAAAGCTGAAGCAAATTCGGGATGAGGCAGAAGAGATTCAGCCACTTATTCCAGCCAAGCTCTGGAT
ATCGCAATGGGTGGACTACACGTCCAAGTACGGTATCGGCTACATGCTGTCGAATGGCGGATCGGGTGTGTACTTCAATGACTCCACGAAGATGATTTCA
TCTGCTGACGGGAAAGAATTCGAGTACATCGAGCGCCAGAGCAGTCAGAACCCAGGACCGGAGGTTCGAGCCCGCTACACAATGGATAACCATGAGCCGG
CACTCAACAAAAAGGTGACTCTACTTGGTCACTTCAAAGGCTACTTAGTGGACGCTCGAGCCGAGAACGACGAAGCGGACACTCTTGAAAACCAACTCGC
ACGGTCTTTTGTGTTATCACATCACGACGTTGGCCAAGACACGAGTGGTAGCGACGATGTAGCTGCCCAGTCGATGGTTTTCGTCAAGAAGTGGGTGAAG
ACGCGTCATGCTGTGCTGTTCCAGCTTTCCAACGGGACGATCCAattcaacttcttcgacaaaTCGAAGCTCATGCTC