Description :
From Genome Similarity Track
Location :
Scaffold_15:174406- 181463
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08034hypothetical protein
Phypa_INRA-310PPTG_08035N-acetylglucosamine-1-phosphotransferase alpha/beta

Sequence
7057 bases(100 bases per row)
GATTTGCTATCTCATCAGTCAGCGGAAAAGATTTGTGCGACTGTAGCAACTACTGTGACCGTTATAAAAGCCGAGACCCGACAGAATTAGACAAGTGAAT
GGTAATCACAGGTGATCAAGATAGCAGGTACGGGCACTGCAATCAAAAAAATATATATTTGTTTGGTAGTTCATGCGCGGGCTATAGATGCGGGCGAGTA
CCGAATTTATGCAGCGTCAGACTACCCCTATTTCTTTGAATACGCTCAGCGTTCGCACTTGACAATCGCCTGAATTCATAGCGGCGACTCGCTTACAGTC
CTTCGCTGTGTCCTTTTATGGTATGTACCGAATTAATGAGGTGCTGAGTCTGCAGTGCAAAACTCACACACAAGGACTGATGACCGAGAATGTGCTTCCA
CCACTAACGTGTCTATCACGTACGACGTTTATAAATTCGGCGGAAATTCAATAAACAGGTTGGCTGACGTTCGTACCGCCAAAGACGGAGCACAAGTGGA
ACCAGAAGGACTACATTTTACTAGCACTGTCCAAAACTCACGGAGAGCGTTATTTAACCAGATGACTCTTCTACATGCTGCTAGGATGCAGGAGTGGAAT
CGGGTAGATATGATTTCTAAGTAGGCTTTCATAGCATTTCTTACTCATCTATGCTGTTCGAAATTTCTATCGTAATGGGGTCTCCCCAACAATGGCGCGA
TATATGATTCAAGTCCCACACGTCCCACCGCGCTGGTACTCAGTACAGGTTTATGTTTGCGCCATCTGATCGACTTAGGTCACTACGCATGATGGAATGG
CGGGTTGGAACCCTTGTGCGAAATCGGCTTGACCAAGCGGCTGCGGATGAAGGCTCACAACGGGCGGACTGTTAAGCACTTGATCACAAAGCACATATAA
TCTGGTTTACTACATTTTACCGACGCAAGCACAACGTAAAGGCACCGTCGCCACAGCCCTCTTTATCTATTGAAAACAATACTGAAGGCACTTTAAATTC
CAGTGAAATGGATCAACAGTAAAATAACGTGCTACACCATATCCAGTCCAAACTGGGACACCCGCCAGAGCTACGCCATATCGCTGCGTCTCCGATGCTC
TCGCCAAATCAGCAGGAAACTGCCACGGAGGAGGAGTGCCAACGCGTTCTGAGCGCTTACGTGGCTGAGAAAGACTGGCTCACAGTCGCCAGGCACAACG
GAATTTTGCGCTCTGCAGCCTATCGACTCTGTAATTCTGGGAATCCTACTCTACCTAAGAGCGGTAGTGCGCGCGACGTCTCAACGAAGTGCACAGATGA
ATTATCACTGCGATGAAGTCATACCTGGAAGAACCCTGCACGCTTTCGTTAGAGCGGCTTAGCGAGCGAGTTGTGGATGACTTCGGAGTGACGCTGTCCA
CGTCTACAATCAGAGTCAAGTTGCCAAACAAACTGATCGCAGTTAAGCAGGTATCAGAATGATTTGTTTAAAAATATTATTGTGTGATCTAACATTTATT
TTATTGATAATCTGCATGTATATGTAGGCCTGTCGTGAACCCTCGATGTGTAACAATGAAGTTAATAAAGTAAAGTGCAAACTTTTTGCGGAGATGTTTA
TTATACACATCGCGGACGGCGACTACGTTGTGTACTACGACGAATCCAACAACAATCTTTTTTGCATTCGTTTGCAAGGCCGCGCTGTGAAAGGAGAGCA
TTGTGTCGTCAAGCGTCCCCCCTTCTCACGGGAAGAACTTGAAAGTTCAGTGTTCAGTATCGACTGAAGATGTCCTCGTGCTGCACCAGCTTCGACGGGG
GAGCATCTGTATGGAAGAGGATGCGGAGTTTGCCAAGCGCGCTTACACCACCATTAACTGTTTGGAGAGTTTCCAGCGGCATTTTGAAGGGCGGACGATT
GTCATTGTCCTCGACAATGTCCCCACCCACAATCCAACCGAAAGTCGACTCGAGGAGGAGCTTGGAGAGCACATCGAGCTTGACTTGTTAAGGTTGGTGC
CCTAATCAATGGTCATAGCCGTGCGCTGTCTCACTCAGCTCTAGTGGATGCCCCAGTTTGGACTGGAAATGGTGTAGTCTACCAAAGTTCAGCAACCTCA
AAGGTTCAAAGGGGGGGGGGGGGGCTCTATTTGGAATGCCGAGGCAGTACGCCATCAGTTCAAACTTATCAAGGGGTTGACATCTGCTGAGCGAAAGACG
AGTGGGACATTGTCTACCACTAAGCAATACGAAACTAATCGCTAAAAATGTAAGAAAACTCCATTATTGGAAAGGGGCTCAAAATGCTGCCAATTCAGCA
TACTATCGATGTATGTAGCCTACTACACGAACCACTGGCTGAAGGTCGCAGTGGGTTCAACCACAAACGCGCTTACAATTGATGTCAGCACGATACATCC
GTCTTGAGAGGAAATCCAGACGCGACAAGCCTAAGCAAATCTCTTACCAACGTGTATCCTGTGATCAATGTGTACTATGTCTCTCTTCCGTATTTCGTGT
TGATATCGGAACCATGCTCAGTTTTCTAAAAGCGCGGCATATGCGCCCTTGCGTCAGACGCGTTCTATGACCCGACGCATGTCGTTAGTAACAGGTAGGG
TAATCTAACAAAAAGTAAATATTTTCCTGAAACCTAACCTCATTTGAGCAATGGAAACGCTTTACTTTTTCATATCACGCAATCATTCTCGGTGTACCAT
AAATCTGGTACATTCCCTTCTCTGGCTCCTGTGATGCTGTCGCATACAAACCCCCAGTCAGCGAAGCTCCCTCGAGTCGCCTCGACCACAGCAAAACTCC
CCACCTACGGACTGCGGAATTCCATTCCAATGGCTTCCATTGCAGCTTCCCCAGGTACTTGATCCTCTCTCTCTTGCTCTCCATGCATGTGGCCACGTCT
TCCCACCTTCTTCTGTCTCTGGCCATGTCTATAGTCTACCCTGACGGCCTCAAGAAGCGCTCGCGACTGGCCGACTCTTTCGACCTCTCAAGGAAGCGTC
AGCGTCGCGGAGTAGGCGAAACTAGCGGCCAAGACGAGGCCACCGACGACGCTGACGTGGCCAAGTACAGTCAGCGCCATGTCGAGTACTTTGAGCAGGT
GAAGCAGGCAGAGATTGCCCGAATAAGGGCCGAGTACGAGCAGTTCATCATGAAGAAGGAGGCCGATTTCCAGCGGCTCGGCCAGGAGCTGCAGCAGACA
CAGGAACGTGTGGCCGTTCAGGCCAACGACGTGGCCAGACTCCAGAGCGAGAACAAGCTGCTGAAACGCGCCGTGGCCATCCAGAACCAGCAGAAGGACG
AGGTCCAGAACGAGAACAGCGCGCTGAAACAGCTGGCCACTCAGGCCGCCGAGCACATGAAGCGTCTAGAGCAGGCCAACTACACACTGAGGGTCCACCT
ACAGACCAGCACCAGCTCCGGCATCGGCCACCAGCAGCAGCCGCCAGACGTGTACTAGGCCATCGACGGCCAGCAATGGCCGTACGTGGCCAGCCAGGCC
TTGGCCCTCCGCGGCCCAGGTATTCTATAGACAACCCAGTCCCGTTCTACTACTATTCATTATTCTATGGGCTGCACGCCGAAGCGTCAGACGCCAAAAG
CTACCAGATCAAGGCACCCAACGTCCAGATCTGTCGTAACTCTGCTATTTTTCCCGTTTCCAGACCAACGAGACGTGCGTGGTGGAGGGCCGTCGGTTAG
TCATCTACCTCGTGCTCTATCGACCAAAGACTACGGGGGTTTTCTCCTCGATGTGACGCAGAAGAGAGTGCAACGTCTGAACGTTTCCTTACATTATTTC
GCAAAAAGCATTAAACCCACAAACATCTGATGCCAACTCCTCAATTGTTAATGCACTTACTTTCATTGCGTTCCTCTACTTTCTCTAGGCCGACGCCTTC
CTTGGACGTCGCTTACTCGTTGGGTCGTCGTCCTCTTTATCCTCTTCATCTTGAGCTTGCTGGAAGTCTTGAGTAAGTTGCGAAGCTGATGCAGCACGTG
CCCGCGCGATGTCCTGGAAGCCAAACATTGCACGGAGCTCAGCACGGAAGACGAAAGCGATCAACAGTAAGATCACGACTGCAATGGCTGCTGCAAGATG
ACGACGCTCTTGTGCAGCATTAAACTCGTCGATGTGCGCATAGCGGTTCTTCAGATGATACGGTAGTTCGAACTGCGAGCGTTTGGGCCAAATAGACAGG
AACAGTTCGTGCAGGATCTGACTCACTGCAGTCGACGGGTTCTTCATGTCGTCATTAATACACACAAACTTGGTGCGTCGTGCTCGCGTGCCCATCATTT
GTTTCCATGCAAACTTGAAATTGTCACTTAGCATGTGGAACGTAACTTCAGTCTCCGGCATCAATTCCACCTTGGTCTCGTATCGTACGTTCTTGATGAG
AGCGTCACGTACTGAAGGACATCGCTCGAGGTTCTCCAGAGTAATATACGGCGTCAACGTCTCGCTGAGTCTCAGTGTTCCTTCAGCTGTCGGAATCTCG
CGAACCTTCTCGCGTTTTTCAGGCTGGACACACTCGCGCACTTCGTTCACGAAATCCTCAGGCGGGGCGTCGCCGTGTGCGAGACTAGCAGCAGTCAGCA
CTTCGTTCTCGTCCAAGATCCCGTTACGGTTGGCGTCCAGGTATTCTCTCCAGATTTCTTCTAATGTGTGAGGGTGGATCTTGGCGCGGTTGATCAGATA
ATGGAAGTATGAGAAGCTGAACTGCATGTCTTGAGGGTGACGGAAGCGATGAGCACTCGTATCTTGAATCTCCTTGGTCCAGTGGTCCTTAATCTCACGA
ATGATAGACTTTTGCAGCAAGAAGGGCATGTGAGATGGTACACGTCGTCGATCTGATGTCTTTGGCTTGCCAAAGGCGCGGTTGTACAGCTTGTTGACAT
AACGCAGGGAGTCTCCAAACGTGTCCTTGGAGAGGTGAGCTTGTGCGTCTCGAAGTGTAATCTTGGGCTTTTCTTCCTTAGGCTCAGCAGGACCACAGAC
GTCTGCGTATTCGACGTCATCCAAGCTTTCGTTAGTAGACACGACATGTCCAAGACCGACGGTCGTCTTGATGTTCCCAACGAGGCGACTCAAGCCTCCA
AAGAGGCCACTGGATTGAGCTACTCGCTCCTCCTTCTCGCGCTGTTCACGTTGAACCAATCGCCGCTTCTGGGCTTCACAGGCGAGACGACGACCTTCTT
CTTCCTTCTCTTTTTGCAAGTCCACTTTATCTTCGTCCTTGGCAGGACGCGGGATAGGCACTTCGTTCTTGTAACACAGTCGAGGACGAATGCCGATGAG
ACGTCGGGTGGTGTCAATACAACGGTCAAGCAGCTCAAGTAAAGCTGGGTCATCGCCCGTGTATGGCGTATACACTACTTTAGGCTTGGGCGGATGCAAG
AGAGCCCAGAGCGTAGGCTTGTGCATCAACTCCACTTCTTCCGAGTGGTAGTGACCCAGTGCTAGAGCGAAGCAGTAGCGATAACGTGACGGATCAGCAC
GGTCCGCATCGAAGAAGCAGATTTGGCCGTCAGCGGCCTGCGGACTCGTCTTCCACTCCTCCATCATTTTGTTCACTGCACTGTAATCAATTCCATTCGT
ATCACTAGCTGCAGAGCTGCTTGTCTCGGGAGTATCAGGAGCATCTGTTTCACTCTCCTTCTCCTCGTCGTCAAGAACTCCAGTAGCAGAGAGTATAGCG
TGGGCGTGGTTCGTCAAAACTCGCACAGTGACAATGACACCACGGTTGTCATCCGCAAGCCGACATTTCGTGATACCGCCATCGTACTCAGCAACTTCTG
CCTCCATATTCTCGTCCTGATTAGCTTCATCCTGAGCAGCATCTAGCGTCTTGTCATTCTGCTCAATCTTCTCTTCCAGTGAATCCGCAAGGAGAGGAAT
AATCATATCTTCAGCTTGGTCTTCACCCGCTACAGAACCTTCTTTCCTGCCGTCCGCGATATTTTTCTTTGCTTGACCAGCAGAATCATCAGTAGCAGGT
TGTGTCGCTGGTTTCTTCTTCGGCACCTTCAACTGGCAAACATCGTGGTCACTCCAGTCGATATCCTTTACGTCGTTATGCAGCCGCAAGTCCATGTTCC
ATCCGAGGTTTAGAATATCGCCGTCGTTCAGCTTCTTTCCTGTGATGTTAAACGGCAGAAACACCTCAATAAGCGGCACTTTGTTAGCCAACTTGTTTGC
AACAACAGCGATCTGCCCATCTAACAAAACCTCCTCTCCATCTTCTGACGCCGTTGCAAGTTTTATCTCTGTTTCTTCATCAGTAGAAGGCATAACATTG
CGGAACTTAGCTTGTCGAAACCCAAAAGGCAGACGGATGAGTTGAGGCCGGATACTGGTATTTTGGAACGTGGATACACCGCTGGAAATCTCTTCAACGC
CTTCCACTTGAGCAGGACTCGTAACCTCTTCAATCTGGTTCTTTCCACGCATCAGCGAGAAGTCCAACTGGATAGGAGTACCTTCCGCATCTTCACCAAC
AACTGTGATCTGGACACTACTCGTCATCGGATTGGCATCCGAATCGCGACCAAACACTAGTAACAGCACCATTTCCTTCTCGTATACAGAAGCGAAGCGA
ACAAGCTCTTCATTATCATGAGCAGCACTCAAAATGCTGCCATTGACGCCAAACGCATCCGTTAGATTCATGTACGTCGCGTTCACATCCAATGGCACCT
GCACAAGTGTGTGGTTCAACTCCACATCCGCCGACCACAAGTCCTTCACCAATGGTGACATGCCTTCATCTTCCTCGTCGTGAAGATAAGGTCTGTTTCG
GTCATAGGGCTTCACCACTCTGCAATCTCCTCCATCAAACGCACACGAGCTCACGTTACACGTACGATCACACATTCCATTTCCCAGCCACTGATAATGA
CACAATCCTTGACATATATGATTCCCAATCTTTGGCGGCTTGGGCGATTGTTCCAAGATACTCGCGATCTTCTCTGCATCACACGTCACCGATCCATCCA
GAGGGTTCACGTCACATCCACAGTCCCCCATGTCAAAGTCACAGGCTGTAACATTGC