Description :
From Genome Similarity Track
Location :
contig_6:174405- 178201
Transcript NameFunction/comments
g2077.t1hypothetical protein
g2078.t1POM64193.1 Hypothetical protein PHPALM_20312 [Phytophthora palmivora var. palmivora
g2079.t1hypothetical protein

Sequence
3796 bases(100 bases per row)
GACCATGAGCGGCGAGGACGTGTCCGTCGTGGCGCCTACACGCCACCGCTACTGCCTGCATATTGCCTACTATGGGACGGACTTCGTGGGGTGGCAACGG
CAGCAGCAAGAGGACAAAAGCAGCTCGGGCCACGACAGCGTGCAGGAAGTCGTGGAAAAGGCCGTAACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACG
TCACGGGCGTCAGTCGCACGGATGCAGGGACCCACGCGCTCTACGTAGGGTCTGATGAAGTGAAACGAGAAGTGTCCGAGTCGGGTTTGCACTAAAAGGT
GACTGTGAATGGGTTTCCGTAGCAATTCGGCTTCATTCGTCTGCACTCAGAGCTGTCGATGTCGCTGGACGAGTTGAAGGACAGAGTCAATGCCAAGTGC
GTGGGGAGTAGTTTGGAGAGTGATGCTGCAGTCTGTGGTTGATGGATTTTGTGTTGTGGCAGACTGGGGAGTGGGCGAATCGAGGTGCTTGGGGTGACGG
TGCCGACGACGGGTCCGTCGCGGATTCGGTCGCGCTGCAAGAAGTACATTTACTATCTGCAGCAAGGCCACCGACCGGATCTGGAGCTGGGCAAGTACTC
GTGGTTCCTGGGCAGACGACTGAGTATTGAGCGGATTCGAGACGCGCTCAAGTGAGTGGGAGATGGTGCTTTGCTTTAGTTGACAAGAAGCCTGACCTGC
TGTTGCTGTACTCGGTAGGCTTTTGGAGGGCACGCACGACTTCCGGCCCTTCTCGCAGGGTCTGCTCAAATACCAGGACATGGCGACTGTGCGGACGATC
ATTTCAACCAAGGTGGTTGTTCGACGGTACGCCCACTTCTTCACGCACCACTCACAGATGCAGCACACGTCTAAAAGCTTTTACTTGGTGTTGGTAGGAA
CGTAAACTTTTCGCTGGATCCGCAAATGTGCGGCAGTGGGGAGATCATCGATGCTGCTGACATGTACCTCGACACGCCGGTCGGAACAACCTCTGAGCAG
CACAATTCGGATGGTAGCAAGGTCGTTGCGACGGAGCATCATCACAAGAAGCGGAAGGTGGAGGAGGCTAAAGGAACTACGCCTGTACACTTCGTCTGTA
TTGAGCTCGTCGCCAACGGATTTCTTCGGCACATGGTGCGCCGCATCATTGGAACGCTGCGTCCAATTGGGGAAGGTACCCAGCCACCGTCGCGAATGCA
GCAAGTTCTAGCAGGTGTGGTCCAGCCAGGGCCTTCCGCTCCAACAAAAGCTCTTTGGCTGCATCGCACTTGGCTGACGCAAGAAGAGTACGACGCGGAT
TGTACTACCGAAGACTAGAGTACCATTGTTGCAACGATAAGATACAGTGCCGACTTGCTGGCACTGCTACTCCATTCACTCGCGCCTTCATTCATTGATC
TATAGCTCTTCGTGGGCACCTGCGGATGCAACAGCTTCTTCCTGCGCAGCAACAATTTCCAAGATCCGAGTGATGTGCTCCAGGATGATCTCTCCAACGA
TTTCTGGAGAGTATTTGGCCACCATGTCTTCTCTCGCTTGCTTGCCTTTCCCCGCTGCTTCCTGCAATAGCAACAAGCCCTAGCGTCAGAATTCAAAGTG
CGAAGAGGAATCACAGTTCATACACCGTACCTCAGGGAACTCCTTCACACGAAGCAGCAACTCTTTCAGATGCTCCACAGAGGGATCGGCCCACATGTGA
CCTCGAAATGCTCCTTCTGTAATCTACACGAACATCCAAAGGCACTCAGCCACACACACACACACACACACAAGTTGCTGGCAGTGCGCTTAAGCTTACC
TCAATGAGTCCGTCAATCTTGAGCGGGTACGAGTTTTCTTCCGTCATGTATTCCGTAGTGCCGCTCCAAAAAGTAGCAATCACAGGCCGCTCCATGGCCA
TGGCCTCGACATGCGGTCGGCCCCATCCTTCGCCACGCGACGGCAGGACAAACGCGTTCGCAGCCTTGTACAAGGCCGGCATGGCCTCTTGCGGGATATG
CGGTGGCAACACGTGAAGGTGCGGCAGCTCATGAAGCTTCTTGCCCACGGCTTCTACCGCAAATTCCTCAATTTTGTTCAAAAAGTCACCGGCCGACGAC
GATGAGCTGTGATACCCATTCGTCAGCAGCACCAGCACCACGTCCTCATGTGCCTCGAAAGCCTGGAAGTAGGCCGTCAACAAGACCTTCCACGCCTTCC
TCTCCTCCCACTTGAAAATGGACAGGTACACGGTCGTGTGCTCCGTCAGCTCAAACTGCGTCTCGCTCGCTAGATCGTACGGCGTCTCCACCTTCTCGGG
GTCAAAGAATGCCACATCCACCACCTCGGGCACGACCTTGACCGCTTCTGGTCTCACTCCTCCATCCACGAAAACCTTCTCCTGGAACTTGGTGGGCACC
CAGATCTCGTGCATCTTGTTCATCCTGTCGGGCCACCCTTGGGGCACTCTGTCCGTCTCGAACATAGTCCGTCCGACTGTGTACAGCGCCCCACCTGGAG
GACACTTGGACGTCATGTAGTGGGCGGGCTCCCATGCTCCAGGTTCCGAGTGGCAGATGGCGAGCGCGATTTTCCGGTGCTGTAGCCGCCAGGAAACGTC
CCGCTCCTGGATCCAGTGCAGCTCCAGCGTCGACTTCATGCCCTCCGACAGGTCCTGGATGAACGACGGGTTCAGTGAGTCCCCGTGCTGCGTGATCAGC
AGCTCAAAAGGCTGCTCTGGCATTGCGTCGCTCTGTTCGGCAGCTTCTGCTTGGCTAGAGGCGGAAATGGAGCGTTTTGGGGCAGATTTTGACCAAGAAT
CGAGCGCGGCGTCAACTGCCACTACGTAGGACTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGCGCATACCACAATACAGCAGGAGGTCCCGC
TTCACTGCTGGCGGCGGCACGACGCCCGAAAGCGGCTGTGGACGGCACTAGCAGTGCGCACAGCACGAGCAATAGGTGCATCATCTTGTTAGCACTACGG
ATCGAAATGTCAAGTTTGGATGATAATTGTTGGGGAAATGTCAGGTTAGGTTCGGAAAATGTCATGTTTGGATGATAATTTTTGGAAATGCTGTGCGAGA
CCATCATGGCTGACCTAAAGTTAGGACGCATACTGGTTGGTCCAGTCCTGCGCCGTCTTGTCGAAGTCGGCCTTGTTCTCGTGCATCTGCTTGGCGATCT
CTGGCTCCAGGGGGTTGTCCATGTCTGGCTGCTCCAGGATCTGCTTGATGGCAGTGAGGCAGTGCATCACGTTGAGCGTCGGGCCCCAGTTCTGCAGCGA
CAATAGCGACAATAGCAACAGCAGTAACTAATGAGTCATCAACATATCTCAACCTGCTACTGCTACTGCACGCACCTCGTTGATGATGTCGGCACAGATC
TCACCCGACTGCGACTTGACGTTCGGGTGGTACACGCGCGTGAGGAAGCGCACTTTGGGAGCCTTGAACGGGTACTCGCTCGGAAACTGCAGGTCCAAGT
TGAAGACGCCGCCCGAGTACGGCGAGTTCTCCTGCAGCAGCAACACAACCAGTGAGGTCAAGGGCCTCTCTACAGTCTTCTCTATTGGTGCCACGTACGG
GGCCGGCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACTGTGCACCAGTCGGGCGAACTCTTCTCAAACTCGGCGAGTTCCTACAG
CAGACACTCGATTAGTACGCGGTCGGGTCGAGTGCCTTGTAGATGGACGCACCTTAGTGAGACGGCGAGCCATGATCTACAGGCTGAGGAGAAGGA