Description :
From Genome Similarity Track
Location :
contig_6:174401- 178197
Transcript NameFunction/comments
g2226.t1RAW37607.1 hypothetical protein PC110_g6143 [Phytophthora cactorum
g2227.t1POM64193.1 Hypothetical protein PHPALM_20312 [Phytophthora palmivora var. palmivora
g2228.t1hypothetical protein

Sequence
3796 bases(100 bases per row)
GACCATGAGCGGCGAGGACGTGTCCGTCGTGGTGCCTGCACGCCACCGCTACTGCCTGCATATTGCCTACTATGGGACGGACTTCGTGGGGTGGCAACGG
CAGCAGCAAGAGGACAAAAGCAGCTCGGGCCACGACAGCGTACAGGAAGTCGTGGAAAAGGCCGTAACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACG
TCACGGGCGTCAGTCGCACGGACGCAGGGACCCACGCGCTCTACGTAGGGTCTGATGAAGTGAAACGAGAATTGTCCGAGTCGGGTTTGCACTAAAAGGT
GACTGTGAATGGGTTTCCGTAGCAATTCGGCTTCATTCGTCTGCACTCAGAGCTGTCGATGTCGCTGGACGAGTTGAAGGACAGAGTCAATGCCAAGTGC
GTGGGGAGTAGTTTGGAGAGTGATGCTGCAGTCTGTGGTTGATGGATTTTGTGTTGTGGCAGACTGGGGAGTGGGCGAATCGAGGTGCTTGGGGTGACGG
TGCCGACGACGGGTCCGTCGCGGATTCGGTCGCGCTGCAAGAAGTACATTTACTATCTGCAGCAAGGCCACCGACCGGATCTGGAGCTGGGCAAGTACTC
GTGGTTCCTGGGCAGACGACTGAGTATTGAGCGGATTCGAGACGCGCTCAAGTGAGTGGGAGATGGTGCTTTGCTTTAGTTGACAAGAAGCCTGACCTGC
TGTTGCTGTACTCGGTAGGCTTTTGGAGGGCACGCACGACTTCCGGCCCTTCTCGCAGGGTCTGCTCAAATACCAGGACATGGCGACTGTGCGGACGATC
ATTTCAACCAAGGTGGTTGTTCGACGGTACGCCCACTTCTTCACGCACCACTCACAGATGCAGCACACGTCTAAAAGCTTTTACTTGGTGTTGGTAGGAA
CGTAAACTTTTCGCTGGATCCGCAAATGTGCGGCAGTGGGGAGATCATCGATGCTGCTGACATGTACCTCGACACGCCGGTCGGAACAACCTCTGAGCAG
CACAATTCGGATGGTAGCAAGGTCGTTGCGACGGAGCATCATCACAAGAAGCGGAAGGTGGAGGAGGCTAAAGGAACTACGCCTGTACACTTCGTCTGTA
TTGAGCTCGTCGCCAACGGATTTCTTCGGCACATGGTGCGCCGCATCATTGGAACGCTGCGTCCAATTGGGGAAGGTACCCAGCCACCGTCGCGAATGCA
GCAAGTTCTAGCAGGTGTGGTCCAGCCAGGGCCTTCCGCTCCAACAAAAGCTCTTTGGCTGCATCGCACTTGGCTGACGCAAGAAGAGTACGACGCGGAT
TGTACTACCGAAGACTAGAGTACCATTGTTGCAGCGATAAGATACAGTGCCGACTTGCTGGCACTGCTACTCCATTCACTCGCGCCTTCATTCATTGATC
TATAGCTCTTCGTGGGCACCTGCGGATGCAGCAGCTTCTTCCTGCGCAGCAACAATTTCCAAGATCCGAGTGATGTGCTCCAGGATGATCTCTCCAACGA
TTTCTGGAGAGTATTTGGCCACCATGTCTTCTCTCGCTTGCTTGCCTTTCCCCGCTGCTTCCTGCAATAGCAACAAGCCCTAGCGTCAGAATTCAAAGTG
CAAAGAGGAATCACAGTTCATACACCGTACCTCAGGGAACTCCTTCACACGAAGCAGCAACTCTTTCAGATGCTCCACAGAGGGATCGGCCCACATGTGA
CCTCGAAATGCTCCTTCTGTAATCTACACGAACATCCAAAGGCACTCAGCCACACACACACACACACACACAAGTTGCTGGCAGTGCGCTTAAGCTTACC
TCAATGAGTCCGTCAATCTTGAGCGGGTACGAGTTTTCTTCCGTCATGTATTCCGTAGTGCCGCTCCAAAAAGTAGCAATCACAGGCCGCTCCATGGCCA
TGGCCTCGACATGCGGTCGGCCCCACCCTTCGCCACGCGACGGCAGGACAAACGCGTTCGCAGCCTTGTACAAGGCCGGCATGGCCTCTTGCGGGATATG
CGGTGGCAACACGTGAAGGTGCGGCAGCTCATGAAGCTTCTTGCCCACGGCTTCTACCGCAAATTCCTCAATTTTGTTCAAAAAGTCACCGGCCGACGAC
GATGAGCTGTGATACCCATTCGTCAGCAGCACCAGCACCACGTCCTCATGTGCCTCGAAAGCCTGGAAGTAGGCCGTCAACAAGACCTTCCACGCCTTCC
TCTCCTCCCACTTGAAAATGGACAGGTACACGGTCGTGTGCTCCGTCAGCTCAAACTGCGTCTCGCTCGCTAGATCGTACGGCGTCTCCACCTTCTCGGG
GTCAAAGAATGCCACATCCACCACCTCGGGCACGACCTTAACCGCTTCTGGTCTCACTCCTCCATCCACGAAAACCTTCTCCTGGAACTTGGTGGGCACC
CAGATCTCGTGCATCTTGTTCATCCTGTCGGGCCACCCTTGGGGCACTCTGTCCGTCTCGAACATAGTCCGTCCGACTGTGTACAGCGCCCCACCTGGAG
GACACTTGGACGTCATGTAGTGGGCGGGCTCCCATGCTCCAGGTTCCGAGTGGCAGATGGCGAGCGCGATTTTCCGGTGCTGTAGCCGCCAGGAAACGTC
CCGTTCCTGGATCCAGTGCAGCTCCAGCGTCGACTTCATGCCCTCCGACAGGTCCTGGATGAACGACGGGTTCAGTGAGTCCCCGTGCTGCGTGATCAGC
AGCTCAAAAGGCTGCTCCGGCATTGCGTCGCTCTGTTCGGCAGCTTCTGCTTGGCTAGAGGCGGAAATGGAGCGTTTTGGGGCAGATTTCGACCAAGAAT
CGAGCGCGGCGTCAACTGCCACTACGTAGGACTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGCGCATACCACAATACAGCAGGAGGTCCCGC
TTCACTGCTGGCGGCGGCACGACGCCCGAAAGCGGCTGTGGACGGCACTAGCAGTGCACACAGCACGAGCAAGAGGTGCATCATCTTGTTAGCACTACGG
ATCGAAATGTCAAGTTTGGATGATAATTGTTGGGGAAATGTCAGGTTAGGTTCGGAAAATGTCATGTTTGGATGATAATTTTTGGAAATGCTGTGCGAGA
CCATCATGGCTGACCTAAAGTTAGGACGCATACTGGTTGGTCCAGTCCTGCGCCGTCTTGTCGAAGTCGGCCTTGTTCTCGTGCATCTGCTTGGCGATCT
CTGGCTCCAGGGGGTTGTCCATGTCTGGCTGCTCCAGGATCTGCTTGATGGCAGTGAGGCAGTGCATCACGTTGAGCGTCGGGCCCCAGTTCTGCAGCGA
CAATAGCGACAATAGCAATAGCAGTAACTAATGAGTCATCAACATATCTCAACCTGCTACTGCTACTGCACGCACCTCGTTGATGATGTCGGCGCAGATC
TCACCCGACTGCGACTTGACGTTCGGGTGGTACACGCGCGTGAGGAAGCGCACTTTGGGAGCCTTGAACGGGTACTCGCTCGGAAACTGCAGGTCCAAGT
TGAAGACGCCGCCCGAGTACGGCGAGTTCTCCTGCAACAGCAACACAACCAGTGAGCTCAAGGGCCTCTCTACAGTCTTCTCTATTGGTGCCACGTACGG
GGCCGGCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACTGTGCACCAGTCGGGCGAACTCTTCTCAAACTCGGCGAGTTCCTACAG
CAGACACTCGATTAGTACGCGGTCGGGTCGAGTGCCTTGTAGATGGACGCACCTTAGTGAGACGGCGAGCCATGATCTACAGGCTGAGGAGAAGGA