Description :
From Genome Similarity Track
Location :
Scaffold_608:1744- 4049
Transcript NameFunction/comments
g11432.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
2305 bases(100 bases per row)
CAACGACATGATCAAGGACGCGAAGGCACCTTCCAAGTCGAGTGGACCAAGCGTGTGTCGCGGCTGTCAGCAAGGCAAAATGGTCCAGAAGCCGTTCCCA
AGCAACCGTGACAAGCGTCGCTACGACACGTTCGAGCTGCTCCACTTCGACATCTGCGGCCCCGTGGAAGAAGAGTCACTGGGTGGCAGCAAGTATCTGC
TGCTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGGTTCTGCCTGCGTGCCAAGTCGGAGAGCGAAGACTGTATCAAGACGTACGTCACGAAGGTGCA
GACGCAGTTCGGCAAGAAGGTCAAGTTTGTGCGGCACGACGGAGCTCGTGAGTTTGCGACCAACTCGCTCAAGGCCTTCTACGAAGTCGAAGGCATCGAG
CAGCAAACCACGGTTCCGTACGCGCACCAGACCAACGGCACGGCAGAACGCGCTATCCGGACCATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCA
AGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTAAAGAACCGCCTGCCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGAT
TGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCCTGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAG
GCCCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATCGACTTTATGACATCGAGGCGGGGCAGGTGGTTGTCAGTCGCGATGTCAACT
TCGATGAGTCGGCCTTTGGACTTTCGGCGCATACCTCGGATGAAGACGTCGATGATGCTGCGCTGGACCTGGACGCGCTGGACCTGGACGACACCGATGG
ACCGCGCCAAACGAGCTTCAAGCAGGCGGGGAAGCGCAAGAACCGACCGAGTGGCGACGACGACACTGCCAGAAGATCGCACCCCGTTCGCCACCGAGCT
GGCTTAGAAGAAGCAAGTGCGCCGGACGTATCCTCGTCGCGCCGAGCTGAACCCGACGAAGAAGAAAAGTCTGGGGACCAAGATGAAGATGACGACTCGA
CGCCTCCAGTGTTTTGGCGTGCCAGTGCCAACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCGGTGAACGGCCCGGATCA
AGTGCACTGGCGCAAGGCGATCCGCGCGGAGCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGC
ACCAAGTGGGTGTTCAAAATCAAGCGCAAAGCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCG
ACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGATCATCGCGACCGCCAAGTACTTCGGCTGGCCCCTCGACCAACTCGACGT
CGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTTGACTGCCTGGAATTGGTG
AAGGCCATCTATGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGT
TCCTCTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCTGAGCTGATCGCACGCAC
GAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACC
ACGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGATTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTC
CAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACTGCCACGCGCCCGGACATCGCGTACGCCGT
TGGTTATGTGTCGCGCTTCATGGGGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATC
TGCTTCAAGCCGGGCGAAAAGATCGACTTCCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGTTCA
TGCTG