Description :
From Genome Similarity Track
Location :
Scaffold_290:1744- 2825
Sequence
1081 bases(100 bases per row)
CATGTAGTCACAGATATGACTGCTGCACCGGCGGCTTTAGGGACGTCAGGTTTCAGTACGATAACTTGATGAGAAACTTAATGCTAATGCAGATATTTAG
ATGCTTCACCATATGTTTCGCTTTCATTCATGCAGATGTAAATATTTCGGTCGGGTGTTGTGGTACACTGCTATAGCGTCTCCAGGTACGGAGCATAAAG
AAAATAATTGGTGATCCACGATGCTGCCCTGTAAACTTTAATTTCCCTGTGCGCATTCTACGATGCAATTTGACGACTTCGAATTCAACCGCTGCGTTCC
TTAGACACGACAACGTACGATAATTGCACTCTCTGCAGCCTCTAAAAAAAGACTTACTGACAGTGTCGGTTGGCGACGGCTCAGGCATCTGTGCAGTACG
TATCGAGACATTTAGTTGCGAGCCCGAACGGTGAAGATATTAGTGGCTATGCGCAAGGTAAATGCTGGACTTTTCAAATCGTACTTATCTGTCTATGTGT
GTCTGTCTGTAAATAACGCGGTTAGGTATACCTTACACGTACTAAGTGCGATCTAGCCTGTCCCCTCTCATAGACATATAGACATATTCGAAGTCGCTCT
TTAGCTAGGTCACTATTGTGACGCACGCTTGTAATTAGCTTAAAATCAATCAAAGATGATTATGATCACATAAACAAATGCTGGACGCACATAAGCAAAG
GCTGATCGCGTTGCCCAAGTATAATGTACTGTGTTAATACATACATTTACAGCATCATACTCCTTCTTCAGTGACTGCTGCTGTTGTATAGTGTTTTGCA
ACTTGATTCAGTTCTCCGAACTGAATTACTTATATCAGAGGGCGAGCTCCAGAGCTTGCTCCCCTATCTTATTTCATATTTTGTTTCTTATGCGTTTGAT
ATTTTGTACTGAGTAAGTACGGCACCGTTCATGGATTTACACAGGTCAACTGGGTGTGTACAGTCATTCCTCGGATAACTCGTATCCTCATAACTCATAT
AACTTATAAAAATTTGCGTTCCACCATACTTGTTCTATGGTCGCTAACTCATAACTCGTAACTCATAACTATCGAAAATTT