Description :
From Genome Similarity Track
Location :
Scaffold_556:17439- 18564
Transcript NameFunction/comments
Phyta_totarag9244DEAD/DEAH box RNA helicase, putative

Sequence
1125 bases(100 bases per row)
CTTCGACAAGTACGACGACATCCCCGTCGAGACGAGCGGTGAGAACGTGCCGGACCCGGTCACGGAGTTCTCTGCCGAGGAGCTGGGCCCCGAGGTCATC
CGCAACCTGGAACTGTGCAAGTATTCGAAGCCCACTCCTGTGCAAAAGTACTCGATCCCGATCGGCCTGGCTGGTCGTGATATGATGGCCTGTGCCCAGA
CGGGTTCCGGTAAGACGGGTGGTTTCCTATTCCCCACGCTGGCTGCTATGCTGCGTGTGGGAGGCACTCCCCCGCCTGATGTCGGCCACGGCCGTACGCG
CAAGATTTTTCCGGCGGCTCTGATCTTGTCGCCCACACGTGAGCTGGCGTCGCAGATCCACGAagaggccaagaagttctGCTACTGCACTGGTATCGCC
CCCGTGGTGATCTACGGCGGTGCCGAGGTCGGCCGCCAGCTGCGTGAGCTGGAGCGCGGATGTGATCTGCTGGTTGCCACCCCTGGACGTCTTGTCGACC
TGATGGAGCGTGGCCGcatctcgctgtcgtgcATCCGATTCCTGattctggatgaagctgatcgCATGCTGGATATGGGTTTCGAGCCCCAGATTCGTCG
CATTGTCGAGCAGGAGGACATGCCTCGTGAGCGCCAGACGTTCATGTTCAGTGCAACGTTCCCACGTGAgatccagcgtcttgcgTCGGACTTCCTGCGC
GACTACATTTTCCTCACAGTTGGCCGTGTGGGTTCAGCCTCGAAGGATGTTAAGCAGACGGTGGAGTACATCGAACAGTACGATAAGGAGGACTACCTTG
TGCGTTTCCTGAACCAGGTGCAGGACGGTCTGATTCTGGTGTTCGTGGAGACGAAGCGCGGTGCTGACTTCCTGGAGGACATGCTGTGCCGTGAAGGTTT
CCCGGCTACGTCGATCCACGGCGACCGCTCGCAGCGTGAGCGTGAGCAGGCTCTGGCTAGCTTCAAGTCGGGCCGCACGCCCGTTTTGGTGGCTACGGAT
GTGGCTGCCCGTGGTCTTGATATCGATGGTGTGACCCAGGTTATTAACTTCGACCTGCCCAACAACATCGACGACTACGTCCACCGTATCGGTCGCACTG
GTCGTGTGGGTAATATCGGTTACGC