Description :
From Genome Similarity Track
Location :
Scaffold_74:174383- 176711
Transcript NameFunction/comments
Phyci_10629nardilysin, putative

Sequence
2328 bases(100 bases per row)
AGGAGTTTCCGGAATAGCGGTGATGTGACGACGCGGAAAATTGCGGAGGTTAAGTGGGGCAGCTATTCGTTGCAGCTGAGTTTCGACTTTGGCAATCATT
CCAATCGCCACAGCATGGGCAATGTTCCCATGCGCGAAGCTCGCCAGCCACGCCTTCCCTGCCCACAACTGGTTTGAAACATACCCCTGAAGTGATTCAA
CGGTGGCGACTTCCATAGAATCTAAGCACTCCTCCAACGGGAAAGCGCGCTGTTCCAGAAGCTGCAGTCGCAAGTATTTTGCTTTCTGAGACACCTTCGT
AATACCGTTCTTGGATTCACGCATCAACTCCTCTCGCATCACCTCGAAGCGGGCTTCGTTGATCTTCGTTCCGAAAACAGCTGCAACCACCACTTCGACA
AGCAGATGCAATTTGTCGTTAAACCCACCAAAAATGAGTTCGAGACCAGACTCCTTTACGTGGAGCGAGTACATGAGCTCAGCTACGTTGGCGTGATAAG
CGTACTCGTTTAGAGCATCTTGGACCAGCTTAACGTACAGCTGTGTATGGGCCCAATTGTCCACATTCGCCACAACGCTCGGCAAGTGTATCAAAAGCGC
AACGTGGGCACGAGGTGTCGCAAACGCACGGTCCGGCTTGTACCAAAGCTTGCCAAATGACGTCTTTTCACAGACGAGGTCATCCACACCTGTCGTGTCC
ACGAGAGAAAAGTCTCGCGGAATAAACTGGTTCGGTCGAGGCAAATGAAGCTTGGAGTTGATCCCTGCCGTTTTCCAGCGCTTAATCGTGGCGGTAGAAA
TATCCTCCTTCGAATATTTTACTCCAAACCACTCTTCCTCGACGACCTAAATATCCGACACCAGTTAGACTTGTGGCCAGCAAAATTCAAACTATATCAT
TCCATACCTGGGCCTCAAATTCTGGCGTGTCTGCAAATGTTTGTGAAACGATTGAGACACAAACCGTCTCGGCGGTCAAATGGCGTAGTACCTCTTCCGC
AAGCTCTTTCTTGAAGCTACCCTTGAAAAGGTCGTAGCGCAACAAATCTTCTGGCGCAACCTTGAACATCGACTGTAGCAGTAATCGGTTGAGTTAGTGA
AATGTATTTGAGTATCAGTATGATTGATGCAAACAAGGAAGAGCGAACCTGCATGATTTCACCAAGCTCCTCACAACGCTCTACGGCGCTGTCTTCTTCC
TGGAAACGAAACGAAATGTCGGCCAGCGCTGCCAGCTCGTCGAATATCCACGCTGGACAACCGTTTACTCGTAGCATATGCAAGTACTCAAAAACTGCGT
GCGCAATTTCCTCCAAGTGGGAAATTCCCTCCAGTGTGAGCTTCATGGTCACATCAAACTTTGCAGCATAGGTTCCACAGTCGTATCCATCCGTGTCTGT
CACCCCTGCTGTAACAGCAGAAATCCATCCCCGCTCCTTCAGCTGTGATAGATGGACGACGTTCACAGGGTAAGTTAATGAGCACATGCGTCCTCTTCTG
TTTGGTTCGGTCTAACAACGTACATGTGACAGCACTGAGCCCTCGCTTTCATGGCCCAGCAGACTAGCAATGTAATCTGCAGGCTTCTGGTGGTGTTGAC
CAAGAACCGGTGGGATCATCCAGTCGAGGTGGAGCGTGTGAATATCCCGGACGGGCACAATCTTGCAGAGGAACGGGGAGCCTGCGCCATGGGCCCCAAA
CGGGGGGCCGGCCGCCGCAAACGAAGGCACTTTCACCTGCTTGTTCGGGATCGCGCTGAACGACGTTGTGACCCACTGCTCCATTTCGTCCAGCGTGTTC
TCCCCACACACGACGAGCTTCATGATGTTGGCCGAGTAGTACTTCTCGTAGAACTCGACAATCTGCTCGCGCACATCTACGCCCGCCTTCTCGGGCACCT
CCTGCAGACTCTTCTTGTTTCCCCAACTGAAGCGATGGTACGGGTGACTCGCAGGCGACACGTCGCATAGCACTTGCTGcaaccaaccaaccaaccaacA
TCACATATCATCAGTACAGTACCCTCTACTCTACCCTCCTTCTCCCCACCTCACCTGTGAACGGATCCTGTCGTTCTGCGTGGCCTGACTGAACTCAGAC
TCGATGGCCGACAGCTCCCTCTCCATGGCCTCCGCCTTGCACAGCGGGGAGATGAAGAAGTGCGCGAACATGTCCAGCGCCGGCTCCAGATGCGCCGGGC
CCACCTCGAACGTGTAGCTGGTGACCTCGTTGTCCGTGGCACCGTTGCTGTAGCCCCCGTGGGCGCTCAAAAAGGACTCGAACTCGTTCTCGTCCGGGTA
CTTGGCGCTGCCCATGAACAGCATGTGC