Description :
From Genome Similarity Track
Location :
Scaffold_86:17436- 20378
Sequence
2942 bases(100 bases per row)
TGATCGAATTCATGGATGTGTTCCATGAATCCGTGCCATGCGAGTTGCCTAAGGACAAAGGCACTCGACACGAGATCGAGCTCAAACCGGTCTCGAAGTA
CTGTGTCATGAAGCAGTGGCCACTGCCTCGTGAATAAGTACTAGCGATCAACAAATTCTTTATCTATTGCTTTGCAGCGGGCCATTTGAGGGAATCAACT
TCCCCTCACAGCTCTCCGACCTTCCGTGTGCAAAATGCCACAGGAGGGTGGCGGATAGTGCACGCATTCAACAAGTTGAATGTTGCAACAATACCGGCTC
AGACGCCAATACCGAGGAAGGACGTAATTATAGATGGTATGTCAAAAAGTACCATCTTGACTTCTATCAGATCCTCATGCGAGAACGGGATATCCCGTAC
ACATCATTGAGCACCCCAGCGGTATTCTGTGATAGTGGCTAGTGATGCCACAGATAGTGAGTAATGCCCCTGCAACTTTCAACAGATGTGTAACAAATCT
ATTGAGACCGGTGCGAGATTTGCACCGAGTTAATTTGACGATGTGTTCGTCCATAGCCGGGCTATGGATGGAAAGACGGACGTAGAGGTTCATAGAACAC
ACGTTCGTCAGGTTCTTACACTTATGCGGAATCATAAGCTGTATGCCAACATCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCAT
CGTAGGTAAACACGGCGTATTCCCTGATCCCGAAAAGATCAAGGCGATCACCGACTGGCCCGTGCCAGTCAAGGGACTAAGGAAGTTCCTTGGGCTAGCG
GCGTACTTTCACAAGTACTCGCGCAATTACGCCGAAATGACTGTGCATCTTTCTTGTTTACTCAAGAAAAATGTGAAGTGGTCATGGAACGCTGACTGTA
AGTGTTCATTTAAAGGTATCAAACAGAGCTTGATGCAATCGCTCATACTGGAGATTGCAGATCAGGACAGACCATTCCACGTGGTCTGTGACACCAGAGA
TTTTGCAATCGGCTGTGAGTTGATGCAATTTGATACAGATGGCGCAAAGCGCTTCATCTGCTACCATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATC
TAGTGCGTGACAAGGAATTCCTTGCCATGAAATACGCACTGGCTAAGTTTCGTGTCTATCTCTTGGGAGATAGAGCGTTCGTTGTCTATACGGACCATGC
GTCACTATGCGCGGCCGTAAACAGTTCATATCTCTCGCAAAAATAGCGCGGTGGCTGTCTTTTTTGCGGAGTACAATTTCTCCGTCGAGTACAAGCCAGG
ACGACTGATTGTCGTCACTGATGCGCTTTTGCGGCGACCCGATTTCGAGCCGGGCGCGCAAAAAAACAGTGAGGAGAAGCCCCCTGTTGCGATACTTACA
GTCAGTGTCCTGTCGTCAACGTTACTTGACGACGTAAGAAAGGCCTACGCAGAAGATAAGGATCTTCTGCAATTGATGGATCATCTGGTGAATCCAACTC
GTAAATCGTTGAAAGATTTATCGGCTTTGTACCGTTCCTCATCAAATCGGTACACATCACGCAACGGGTTTCTGTACTATACAGCCGTTGCCGGCGACAC
GACTCGTGTCGTCGTACCCGCTCATAACAATTTGCGCTTGCGCATATTGTATGAGTGTCACGATGCCCCAACAGGTGACCATCGTGGTAAGGATAAGACT
TACCTTACGGTAAGTCATGACTTTTACTGGCCCGCCAGTATCAGTTTGTACGCAAGTACATTCGTGCTTCCGAGGTTTGTCAACGAGTGAAGCCTAGTCC
TTCATCCCGTGCACCTTTACAGCCTCTCCCTGTATCGGCAGAGTGCTGGCAGTCCGTTTCCATGGACTTCGTCTTCGGTTTCCCCGACGATGATCACAAG
AATAATGGTATTCTTGTGTTCGTGGACCGGTTCAGCAAGATGGTGCATCTTGCTGCTGTACCCGAGTCGATCACGGCACAGGGCTGTGCTCGTGTCTTTA
TCGACACGATATTTCGACTCCACGGGTTACCCTGTGAACTCGTGTCCGACCGTGACCCTCGGTTCACGGCGGAGTTTTGGCAATCCGTTTTCTGATCACT
CGGAACGCGATTGAAGATGTCAACATCTGACCATCCCGAAATAGATGGTCAGACGGAACGTGCAAACCGTGTCCTGGAAGAGATACTTCGAGGATACGTC
CACTCGTTCTCGAGTTGGAGTGAATTCCTCCCCATGGTGGAATTCGCCATCAACAATTCGGTGCATGCGTCAACCCAGCACACACTGTTCTTTGTGAATG
GCTTACGCCATCCACGTCTGCCCACCCTCTTAGAGTGTGACTCTTGGATAGGGGGGGAGGGACTTGCTCGAGCAAAAGCCTTTCTGGCTCTTTCTCATCA
CGTGTCGACGCTAACGTCGTCACGAATGATGCCGATGTCGATCAGGTCAACATCGAAGAAGACGGTCACCTCAATAATAGTGATGAAGCTGATGATGACG
ATGCTGGTATCTTCAGCATCGCCAATGACTATTCCAGCGAGGATGATAACACCCTCGCTGACGAACAGAAAGAGGAAAGAACTCTTTCTGCAGTTCGCAT
AAGGCAAACTGAACAAAACTATGTCTCGCCAGCAGAAGGATTTCTGCTGGCTCGAGAAGAAGTGGTCCGTTTCGTGTAGGACTTCATCGCTCACGCGGTG
GATCGGAAGAAACAGAACGCTGACAAGAATGGAAGAGAAGATGTTCTTTCGTTTATTGAAGGCAATTTAGTCCTACTATCTACGGCAAATCTACCTAGAC
ACGTAGTGACCAACGTGGGCAGCAATAAACTACTGCCCAAGTACATCGGCCCCTTTAGTGTGCTGCTCCGACAAGACAACGCATACAAGATCGAGCTGCC
GCGTAGGGTGCGTGCACATCCTACATTTTACGTGGGGTGTCT