Description :
From Genome Similarity Track
Location :
Scaffold_32:174347- 177570
Sequence
3223 bases(100 bases per row)
TGTGCGAGAAGCACAAGTCAGATCCTGCATGCTCTCACTCCGAACTTGCTCGTTGGACAACGGAGCGCTTTCAGACCCCCCCCCCTCCAAGGAGTAAAGC
GCACTACCGTCCAGTGTATTCTTAAGCGGTCGGCGGAAGTTGCCGCCTTGCCGGACGCCAAGATTATGCAGAAGATTGGCGTAAATGTTGTACTGAATTA
ACAAATAAAATATCAGTGCACTGGATTTGCGTCTGGTTTTTGCTTTACGTTGTGCACTTATGCCCTGGCATTGTTGATATGGTCCGCCCTGCCGAATTGG
AGGTGCACGACTGTACTCATGCGACGGTGCAGATGACGCTTGGCGTGCAAGAAGATCCATAACGGATCATTGTTCACTTGAGATTTGTATACTTGATTAG
GACTTCTTATTAGGAATAGACCCGAAAGGGTAAACATAAATACAGAACAGAATTTCATCTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCT
TGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGCTCATCCGGCAAGGTCAAGAGACTTTGTGTATTGGCCGATT
ACTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTTATTCTTCCTACCGAGTGTCGAAC
ACTCGGTGATCTCGTAAAAGGCTTACCCGTCCCTGGTACAATTCCGCTGTTAGGACCACGAGGATTCAAAACACCTATTAGCTTTGCTCGTGCTAGTAGC
GTGTTCTTATTTTTACTGGTTGGCCTATATAAGTAACTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGAGGTCTTCAGGTCCGCCCGAGCGA
TCTTTTACTATCCTAGTAGACGTATTGTTGTGGGAACGTCCTAACTACATTTGTAGCTAGAGTTCACGTGGGAATTCCAACACCACAACTGTGCCGCGAC
CCGGGAACATAGTGTGACCATTGTGAGCGGTTTGTATGGCCTTCCGGTTTACGAGCTACCAAGATAAGAAGAAAACCAAGAAAAACAAGAAACTGGCGAA
AGGACAACCGACGGTACCAGCTACGCCTACCAAGGCTGGCGGAGCTTGCAACGAGGGTTCAAGTCCGGACGTGTCGGCTGCACGCTTTGCAGCCGCCACC
GAGCTTTCGGTGAGGTTTGACGACGAGGCGGACATCGGTCCTGACGCCCACGATTATGACGATTACGAAGACAAGACGCCAGCTCCAGAGCCAGGCACAG
CGACACCGGAGACGGCCCCGCTATCATCGGAGTTGAGCAGGGCTACCAGGTCCCTTTCGAGGAGCCTCGCCGACGAGCTAGATGACGTTGCGGGACCACA
ACCGGTCTATGAAGAATATGACGATAGGACCGAGGGCTCTAAACCTTTGGTGGCGAGTTCAAAGCATTCAGCATTGCTGAACGCACCTCGCTCACCTATC
AACGGTGATAGACCAGCCGCCAAGCGCGTTTTCGACCGCGTACAAGCGCTGATGCAGAATGATGAGTGGATGCAGCTAAGCCCATTCCCAAGAGAAAGGC
CGACTGGCCCGAGCTTGCGCAGGAGCTTCAATACCCAGTCAACTCGGTGTCGACTAGCCAAGTTGCCGAGGATTCAGTTTCGCTACTATTGTCGCTAAGC
TGTGAGAAGGGATACGTACCCATCGACGATGTCGCTCAAGATTGCATCCGCATGAGGCCGAAGCTGCTCTCCAGAAATGGAAGAAGAATCTTCGGAAGGC
ATTTGGCGCTGTCGGCATCAACGCTGGAAAGCTCCCCGTGAGTCGGCCGACCATGATGAAGATCCGTCCACGATTTTGCTGCCGCAGACACCCCCAACGA
CTTGACCATACTCCTCCGACCAAGCGTGGAGCTGATCGTTGTTCCTTTGGTACTACCGAAGCTTCACCGTACTCTCAAGACTCGCACATGGTTACGCCAC
GTTCGGAGAGTCGTATGCAGCGCGTGTACGCTGGTAACGAGAGCTCATTCGGTCGCCGGGGTGGTGCGCGAGCTTCCAAAGGTGGTGCCGGACGTCGTCA
GGCTGACAGCGATGGTTCATCAAGTGACGATGGCAATTTGGTGCGTACATTCGACGAAGAAGACCCTCAAGTCGAGTTGATGCGCCAGATGAATGAACTG
GCAACGCTGAACGACGTGGACCCGACACCGAGGTTTGAAATGGCGTCGCACCGACCATTGGATCTCATCAAGCCGTTCTCAGGCTCTCGCATAAGAGCGA
GAGCTGTATGCAGTGGATCCGTGCGTTCGTTTACGAAATGACTGGAGCGCACACGGATGCTGACAAATGGTGCATTCCATTTGAGCTAAGTCTCCAAGAC
GGTGCCATTCATTGGTTCCGTCAACTTCCAAAGAAGACGAAGCGCAAGTGGAAAGCTGCTGAGCGATGCGTTCATCCGCTACTACTGCTCGCAGTTCACG
CAGACGGCACTGTACCGCTAATACTCTGCAAAGCGGGTACGTAATAAACATCTGTGCGACTACATAACCAGTCTGAATGGCTTCGTTCGAAACGCCCGTC
TACACTTCGAGAAGAGTGGTCGTGGCCTCGAAAGAACATGTACAGCAGCTCATGGCAACGTGCGATGATGACAAGTTGGCGGAAAGTCTCTACCATACTC
GAGTCGCCGACATTCACGAGCTCAAAGAGAACATCGAAAATGTTCTCAAGGGATAAAGAGAGAATGGCCAAGCGTGACAGTGAATATCGATACTCAGAGA
GTCGTGATGCGCGACGCGACGATGCGTACGTCCGCAACAATCGGCGTGATGTCCGTCGCTGTGATGAAATCGTAATAAACCAAGAGTGACGCTCATTGAA
GCCACGGTGGATGACCTACTAGCCGAATTGGAAGGTCGTGAAGCTGCTCAGGGGGGGGGGGCTCCGAGTATTCAAATGAAGATCTGAACGCTTACAACGA
TGTCCAAGACGAGTATAACGACTTTCAGCCCGAAAAACGGATGATGACTTTTCTTGGATGTAATTGACCGATACCTCGCCGCGGCTAACGAAAATGAGCG
ACGTGCAGCCGCTGAAGGCACCTACGCACGCTCGGACAACCGTCAGACGCGTGGGAACACGCCTGATCGCGAGCATGGCTTCAATCAATACCGCCGAGGT
GGTGACCGTGGGTTCAATCAGGA