Description :
From Genome Similarity Track
Location :
scaffold_6:174338- 178144
Transcript NameFunction/comments
g1912.t1 tRNA pseudouridine synthase A, putative
g1913.t1 hypothetical protein PHYSODRAFT_470795
g1914.t1 hypothetical protein PHYSODRAFT_284169

Sequence
3806 bases(100 bases per row)
GACCATGAGCGGCGAGGACGTGTCCGTCGTGGCGCCTGCACGCCACCGCTACTGCCTGCATATTGCCTACTATGGGACGGACTTCGTGGGGTGGCAACGG
CAGCAGCAAGAGGACAAAAGCAGCTCGGGCCACGACAGCGTGCAGGAAGTCGTGGAAAAGGCCGTAACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACG
TCACGGGCGTCAGTCGCACGGATGCAGGGACCCACGCGCTCTACGTAGGGTCTTGATGAAAGTGAAACGAGAAGTGTCCGAGTCGGGTTTGCACTAAAAG
GTGACTGTGAATGGGTTTCCGTAGCAATTCGGCTTCATTCGTCTGCACTCAGAGCTGTCGATGTCGCTGGACGAGTTGAAGGACAGAGTCAATGCCAAGT
GCGTGGGGAGTAGTTTGGAGAGTGATGCTGCAGTCTGTGGTTGATGGATTTTGTGTTGTGGCAGACTGGGGAGTGGGCGAATCGAGGTGCTTGGGGTGAC
GGTGCCGACGACGGGTCCGTCGCGGATTCGGTCGCGCTGCAAGAAGTACATTTACTATCTGCAGCAAGGCCACCGACCGGATCTGGAGCTGGGCAAGTAC
TCGTGGTTCCTGGGCAGACGACTGAGTATTGAGCGGATTCGAGACGCGCTCAAGTGAGTGGGAGATGGTGCTTTGCTTTAGTTGACAAGAAGCCTGACCT
GCTGTTGCTGTACTCGGTAGGCTTTTGGAGGGCACGCACGACTTCCGGCCCTTCTCGCAGGGTCTGCTCAAATACCAGGACATGGCGACTGTGCGGACGA
TCATTTCAACCAAGGTGGTTGTTCGACGGTACGCCCACTTCTTCACGCACCACTCACAGATGCAGCACACGTCTAAAAGCTTTTACTTGGTGTTGGTAGG
AACGTAAACTTTTCGCTGGATCCGCAAATGTGCGGCAGTGGGGAGATCATCGATGCTGCTGACATGTACCTCGACACGCCGGTCGGAACAACCTCTGAGC
AGCACAATTCGGATGGTAGCAAGGTCGTTGCGACGGAGCATCATCACAAGAAGCGGAAGGTGGAGGAGGCTAAAGGAACTACGCCTGTACACTTCGTCTG
TATTGAGCTCGTCGCCAACGGATTTCTTCGGCACATGGTGCGCCGCATCATTGGAACGCTGCGTCCAATTGGGGAAGGTACCCAGCCACCGTCGCGAATG
CAGCAAGTTCTAGCAGGTGTGGTCCAGCCAGGGCCTTCCGCTCCAACAAAAGCTCTTTGGCTGCATCGCACTTGGCTGACGCAAGAAGAGTACGACGCGG
ATTGTACTACCGAAGACTAGAGTACCATTGTTGCAACGATAAGATACAGTGCCGACTTGCTGGCACTGCTACTCCATTCACTCGCGCCTTCATTCATTGA
TCTATAGCTCTTCGTGGGCACCTGCGGATGCAACAGCTTCTTCCTGCGCAGCAACAATTTCCAAGATCCGAGTGATGTGCTCCAGGATGATCTCTCCAAC
GATTTCTGGAGAGTATTTGGCCACCATGTCTTCTCTCGCTTGCTTGCCTTTCCCCGCTGCTTCCTGCAATTAGCAACAAGCCCTAGCGTCAGAATTCAAA
GTGCGAAGAGGAATCACAGTTCATACACCGTACCTCAGGGAACTCCTTCACACGAAGCAGCAACTCTTTCAGATGCTCCACAGAGGGATCGGCCCACATG
TGACCTCGAAATGCTCCTTCTGTAATCTACACGAACATCCAAAGGCACTCAGCCACACACACACACACACACACACACACACAAGTTGCTGGCAGTGCGC
TTAAGCTTACCTCAATGAGTCCGTCAATCTTGAGCGGGTACGAGTTTTCTTCCGTCATGTATTCCGTAGTGCCGCTCCAAAAAGTAGCAATCACAGGCCG
CTCCATGGCCATGGCCTCGACATGCGGTCGGCCCCACCCTTCGCCACGCGACGGCAGGACAAACGCGTTCGCAGCCTTGTACAAGGCCGGCATGGCCTCT
TGCGGGATATGCGGTGGCAACACGTGAAGGTGCGGCAGCTCATGAAGCTTCTTGCCCACGGCTTCTACCGCAAATTCCTCAATTTTGTTCAAAAAGTCAC
CGGCCGACGACGATGAGCTGTGATACCCATTCGTCAGCAGCACCAGCACCACGTCCTCATGTGCCTCGAAAGCCTGGAAGTAGGCCGTCAACAAGACCTT
CCACGCCTTCCTCTCCTCCCACTTGAAAATGGACAGGTACACGGTCGTGTGCTCCGTCAGCTCAAACTGCGTCTCGCTCGCTAGATCGTACGGCGTCTCC
ACCTTCTCGGGGTCAAAGAATGCCACATCCACCACCTCGGGCACGACCTTGACCGCTTCTGGTCTCACTCCTCCATCCACGAAAACCTTCTCCTGGAACT
TGGTGGGCACCCAGATCTCGTGCATCTTGTTCATCCTGTCGGGCCACCCTTGGGGCACTCTGTCCGTCTCGAACATAGTCCGTCCGACTGTGTACAGCGC
CCCACCTGGAGGACACTTGGACGTCATGTAGTGGGCGGGCTCCCATGCTCCAGGTTCCGAGTGGCAGATGGCGAGCGCGATTTTCCGGTGCTGTAGCCGC
CAGGAAACGTCCCGCTCCTGGATCCAGTGCAGCTCCAGCGTCGACTTCATGCCCTCCGACAGGTCCTGGATGAACGACGGGTTCAGTGAGTCCCCGTGCT
GCGTGATCAGCAGCTCAAAAGGCTGCTCTGGCATTGCGTCGCTCTGTTCGGCAGCTTCTGCTTGGCTAGAGGCGGAAATGGAGCGTTTTGGGGCAGATTT
TGACCAAGAATCGAGCGCGGCGTCAACTGCCACTACGTAGGACTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGCGCATACCACAATACAGCA
GGAGGTCCCGCTTCACTGCTGGCGGCGGCACGACGCCCGAAAGCGGCTGTGGACGGCACTAGCAGTGCGCACAGCACGAGCAATAGGTGCATCATCTTGT
TAGCACTACGGATCGAAATGTCAAGTTTGGATGATAATTGTTGGGGAAATGTCAGGTTAGGTTCGGAAAATGTCATGTTTGGATGATAATTTTTGGAAAT
GCTGTGCGAGACCATCATGGCTGACCTAAAGTTAGGACGCATACTGGTTGGTCCAGTCCTGCGCCGTCTTGTCGAAGTCGGCCTTGTTCTCGTGCATCTG
CTTGGCGATCTCTGGCTCCAGGGGGTTGTCCATGTCTGGCTGCTCCAGGATCTGCTTGATGGCAGTGAGGCAGTGCATCACGTTGAGCGTCGGGCCCCAG
TTCTGCAGCGACAATAGCGACAATAGCAACAGCAGTAACTAATGAGTCATCAACATATCTCAACTGCTACTGCTACTGCACGCACCTCGTTGATGATGTC
GGCACAGATCTCACCCGACTGCGACTTGACGTTCGGGTGGTACACGCGCGTGAGGAAGCGCACTTTGGGAGCCTTGAACGGGTACTCGCTCGGAAACTGC
AGGTCCAAGTTGAAGACGCCGCCCGAGTACGGCGAGTTCTCCTGCAGCAGCAACACAACCAGTGAGGTCAAGGGCCTCTCTACAGTCTTCTCTATTGGTG
CCACGTACGGGGCCGGCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACTGTGCACCAGTCGGGCGAACTCTTCTCAAACTCGGCGA
GTTCCTACAGCAGACACTCGATTAGTACGCGGTCGGGTCGAGTGCCTTGTAGATGGACGCACCTTAGTGAGACGGCGAGCCATGATCTACAGGCTGAGGA
GAAGGA