Description :
From Genome Similarity Track
Location :
scaffold_542:17432- 22683
Transcript NameFunction/comments
Pl_103965hypothetical protein PHYSODRAFT_476882

Sequence
5251 bases(100 bases per row)
ACACACATTGGTAGTCGCAGAAGATTTTAAGCAGTATTGACATCACAGAGACTATGGCTACTATGCAATAATTCAGTAGAGACTGCTGACCAAGATACCC
AGTGCAATAGTCAGAGAGAGAAGGTAGTGCAATACGAAGAAGTTAAAGCCTCTTTTGTTGTGTGGTCAGTTGACCTGTAGAAACCAGTCCACGGAGACGT
GAGAAAAATTGGAGGATCATCCGCCGTGAGATGGGGCTGTCCATGCTGTCGGTCAGAGATACCTGATGCTCAGTCCTAGATTTGCTCTGTTGTAGACAAG
TCACTCAAAACACTCATCATAAAGTGAAAGCAACGATGGACAAGTTTGTTGTTGCATTCGTTCTCATCGCTGCTGTATTTCGTGCTACTGCCAGCAGCTT
TAGCCTGCAGTCGTTCGCCACCAAGACAAAGTACTGGGATCAACGCAGTTCCGCAAACTTTTTAGTTGGACAAGCGAATACAAGCATCCAAGACGCAGAT
CTGGAGTTGGTGCAGCTACAACAAGTGAGTCGACACGGCAGCAGGTTACCCACCAAGGGTAACATGGAGGAGATCATAAACCTGCTGGACAACCTCCAAG
CGAATTATTCGAGTGTCATCCCTGACTGGCTTAGGAATTACAAGCTGCCGTACAACACAACGGATGCTGGTGAACTTGCGCCGGCTGGTTTCGCGGAGCT
TGCTGCGTACGGCTCTCGTTCTCGAGTCTCGGTTGGGTCATCCATTCCAACAGCCTACAATGCCAGTCTTTTTAAGCTGGCGCACACAAGTGTGACCCGC
ACAGCCAACAGTGCCCAATCGTACGTGGCACTTCAAGAGGTTTCGTTATCACGTTATTATTACTGTGATGCCTATCATTAACGTTTTTTGCTGGAGCAAT
AGGTTTGCAGCAACGTTCTTCAGTAACTCGGAAGACGTCGAGTATATCGAATATCCCGACGTTTTTAGTGTGTCATATTGCTGTACCCGTTCTCGTTTGA
AAAGTGCGTAAATCTTGTGATCATAGGACCCACTGCTTCGCTTCTTTGATGAGTGCAGTCGTTACAACTCGGAAGTGTTGAACAACTCCAGCGCTCTATT
GGAGCTCGATGATTACCAAACGACTTCCAACATGAACGAAAGCATCGAGTATCTGAAGTCCCAGCTGAATCTCCCCTACTACGCTGACCTGACCACCACC
GATGTTGCATCTGTCTTCTCGGTCTGCGCGTACGTATTGAATTGTCCTAATTTGCCTGCTCGTTTGACTAAATGATGCTTGTGCCCCAGGTTTGATGTGA
TGCTCAACAATGACACCACTCAGTGGTGCTCTCTTGTTGACCAAACATTCCTAAACCGATTGGAATACTCGGAAGAGTTGGAAACCTTCTACGAGCAAGG
TCCCGGATACAAAATCAACTACGAAATGTCTGCCATTTTGCTACAGGACATCTACGCATACATGAAGAACTTCACGACTGGGGATACAACGATCGTTGGT
AATTTTCGATTCGCGCACGCCGAAACCACCTTGCCACTCATGACCCTACTGGGATATGGTGACCGCACCAAGTTACAGGCATCCTGGACTGACACGCAGA
TCAATTCGCGGAGTTTCCGCTCGTCAGTTTTGGCTCCCACGGCTTCGAACATCGATTTTCGTCTGTACCGCAGTAAGACGAACCAAAAGTACTATGTGTC
AGTGTGGATCCAGGAGGTGGAAGCTCCGCTGCCTGGATGCGATGGTGCCCTGTATTGTGAACTGTCAAAGGTGGAGGAGATTTGGGGCTACTACCTCAAC
ATCTACAACATTGTGCAGTGTAGAAATACCATTGGTTGTTTGGCATTTGATCTTGAAGCATGAGTGGGGTGGTAGATTTGTCAATTTCAGGAGGTAAACT
GTACATGGTTAGTAAGTTACAAGTATTAATACATGTGCAACGAAAAACACGTTTGTCGAATGCCTATATAAGTTCTAGTTCATACCTTTCTCCACCAAAA
CCTTTTGCCGTTCATAAGAGTGAGAACGGATGAGAATTGACGTTACACAGACCAAATTCGTTCAGCGAAACAAAGGGGTAAGATGGCAAGGCATTTATGG
CTTCATCAAAACCCAAGTGATCAAGCAGTTTGGAAGACGAAGAGCCTTGAAAATGTCAAAAGGCTTCGAGTCGTTTGACGTGGAAAATCCTCCAAGCTCG
TCGTCACCTTCACCTTTGCCGGTCAAAAACATTGGACGATTCCTCGCTGTCACGTTCACGCTTTCGGTGCTTCTGTTGGTGGCGACGAGTGGCATCCAAG
ATGAAAAGGGCATTTCCGCCGAAGTTGACAGTCTGAATGCTGCTGATACTAGTTTCATGAAACACTTATCGTTTGGGACCATGACGATGTACTGGGATCA
GCGCAGTGCACAGCAGACCCTGGTGCAGTCAAACTCCGTGGTGAAAGGAGTCCAAGCGTCGGACCTTGAATTGGTGCAGATCCAACAAGTTAGTCGCCAC
GGAAGCAGGTAAATTCCTGTCCAATTGAAGAATCACGTCATGTCTTCTCGCCACTAACACAGCAATGTGTTGTTGTGTTTACTCAGGTATCCAACTGATA
ACACGATGCGTGAGATTGCAGATCTGTTGTATAGGCTCCAGGCAAATTACTCGAATGTCCTTCCGGAGTGGATGAAGGAGTACTCGCTTCCTTATAACAT
GTCAGTTGCTGGTGTTTTGTCGTCTACTGGCTATGACGAGCTCGCAGAGTATGGAAAACGCACCCGAACTTCGGTGGGTTTTGCCTTTCCTCCGACGTAC
AACAAAAAGCAGTTTATCCTTGCGCACACTTTCAAGGAGCGCACGGGAGATAGTGCAAAAGCGTAGGTCTTTGATTTTGGAGTCGATGTATTGCTACATG
CAATGGTAACGGCTTCTTGTTTGTTGAATGTGCGCCTTGTAGGTTTGCCAGCACATTCTTCGACAATCCAAGTGACGTTCAGTACATCGAATATGGCGAA
GGAAAAGTACGTTCGAAGCATAATTTTCACAACAACCCGGACTGAAATTGTGCTGTTTTAGGATCCACTTCTTCGCTTCTACGACATTTGTGAGCGGTAT
CAATCGGAAGTGAAGCACAACCCAAACGCATCTGCAGAACTCAAAGCTTACGGAACCTCCAGTCAAATGAATGCCAGCACGACACATCTCAAGACGGAGC
TGAATTTACCTGATAGTGTGGTCCTCAGTGTCACCGACGTCCGTGCAGCCTTCGCAGCTTGCGCGTAAATATGCCTTGCTCTTGTTTTGCCACGATGTTG
ATATGCAAGCTAACACGTTTTCTTGGTGATCTACAGTTTTGACATTATGGTATATGGTATCACGAGTCAGTGGTGCTCTCTCATGGACCAAACATTTTTG
AACCGTCTCGACTACGCGGAGGATCTCGAGGCTTTCTACGAACAGGGTGCCGGTTATAAGATCAACTACGAAATGGCTGCCGTCTTGCTTCAAGATATCT
ACGCTTTCATTAAGAAATTCATTTCTGGTAACACGACTATTGTTGGTAACCTACGTTTTGGGCACGCAGAGACTACGCTCCCACTCATGACACTACTTGG
TTACGGCGATCGTACCAAATTGTTATCGTCATGGAGTGATAATGAAATCAACTCAAGAATCTTCCGCACATCAATTCTGTCCCCCACAGCATCCAACATT
GATTTTCGTCTCTATCGTGGCAAAAAAGATGAAAAATTCTACGTGTCGGTGTGGATCCAAGAAGTTGAAGCTCCACTACCGGGATGTGATGGCGAGATGT
ATTGCGAATTGACTAAAGTTGAAAAACTCTGGAGCTACTACCTCAACGACTACAATTTCAAAACCGATTGTACTATTCCGAAGAAAAAGCGCAAAAACAA
CTCGTAAAATCGGTCAACCAGGTCTTGAATGTAGCCATGGACTAAATTGGACTACAAATTACATACTTTATTTTTTACAATAAAAACGGTATCACCGGTA
TCTTGCTGGTATTTAATTTAGTCCTTCACATTTTCGTGTCCATCGGTCCCATGGCGCCGCGAGTCAATTGGGTCCCTGCGCATGCACTCACGTACAGCCC
TGTATCGACCCACACGTCGTTCGAAGATGCCAAGCTCGCTCTCCACTCGTATGACGCGTTTGTGTACGTCACAGCTTACAACTATGGCGCACATGGCAGT
AGCAAGGTATTCCGCTGCATCTCTCACAAGGACTGTGCGTTTCGACTACGTATTGCTGAGACGACACAAGATGAGGAAGAAATTCCAGTTATTTTCCACT
TAGCAGTCGCTGGAAAACATGGTACTCAAAGTTCCAATAAAAAACGAAAGGGTATTGATCCTTCAGTGAAAGGGGAAGTGGACGGACTGCTAGCCACAGG
TGTTGACCCCAAAAAGTGTCGCCTTACACTCCAGAAAAAATATGCAGATCAACCAGTACTGTTGGCAAAAGTTCCAGATGAAAGGAAATTGAAGAATCGG
TTATCTACGTTGAGAAAGCACGGGTGGAAGATAGCAGAGGCTGGTCTTGCTTCGGATATTGAAACAGGTTCAGGTCTCACACCGCCACCTATCCGTCAGT
CTAGGAGAAAACGACACGAGAGATTTGAACGTTTGGATGACAGTTCTGACGAGAAAGCGTGTTCCGAGTCCGAGTATGAAGTGAGTTCGGTGGAAGATAC
CCAAAGTGAAGAACATGAGATCGCGGATACCGAGATTGACATTGAAGGGCAGTTCGACAAGGACAAAATGATGGAGGAGTTCACTGCGTTGCCAGGACGA
CCGGTATTTTGGAATATTCTCAAGAAGACGAGGTATATTAAAGAAAAGAGCGAAGATATCGTGACACAATGGATTACGGGGCAAGTTATTGGTTGGCAAA
CGAGTGAGAACGCGCCAACGAAGTGGGTGGTGCGGTTTACTGATGGAGAGAAGACAGAGTTAGGGCTTGAAGAGTTAGTAGATGGGATAAAGTCGGCTGT
AGAATTGGGGTTAAATGTTATGGGCAAGCCACAAAGCTACTAGGTGGCGTCTTGCAAGTGAGCTAGGAAGGTGTACTGTATGCACTAGCTGCTCGAAAAT
GGGGGCCAAGATTTATATTCAAATACCGTAAGTAATCGCGAGCGATATCCTCCTGGATACTTTCCAGCGCAAGATATTGCGGGTTTTGGAGCTGCTGTGA
TCTTAGCTTTGTTAGCGAGTTACACCGTGTTGGTGCCTGCAATACGTCGAG