Description :
From Genome Similarity Track
Location :
scaffold_36:174273- 176592
Sequence
2319 bases(100 bases per row)
GGACAGTTTTCGAAACAACCCAGCCTATGATCTCCTGAAGGAATATAAGGACACCGTATTCCGACCGGAGCTACCTGAAGGTTTACCAGAAAAGAGAGAG
ATCGAACATCGGATCGATGTGAAAGATCCCAATCTCGCCATGTATCGTCAACAGTGGCGACAGTCGCCGGAGCAGCAACGAGAAATCGTGAAATGGGTCG
AGGAGATGGTTTCGAAGAAACTCATCCGTCCCAGCATAAGTCCACATGCCGCTCCGACATTTTGTGTCCGAAAACCCGTTGGATGGCGTATCGTCCATGA
TTATCGATACCTGAACACCAACACTATTCGTCAAAGCATTCCCATGACTCGAAAGGAAGATATCCTGGACGTCATGGCTGGAGCTTACTACTTTTCCACC
ATGGACTTGATGTCGGCGTATTATCAAGTTCGTCTGCGGGAAGATGATATCAAGTACACAGCTTTTCAAGCTCCGAATGGACTCTGGGAATATCTCGTGT
TGCCAATGGGTGTATGCAATGCTCCTGCAACGATGCACCGCTTGACATCCAAACTGTTTCGAGGCTTGGAAGAAACGAGATCTTTTTACGACGACATTTA
CATCTTCACCAAGTCTCGTGACGTCCAAGAGCATCTGCAAGCTCTACGGAAAACGCTGGATATCTTGAGGGACAATAAGTTGTACGTGAAACTGGCCAAG
TGTGTCTTCTGTGCGGAGGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAATGGTGTTCGCATGGATCCCAACAAGGTCCAAACCATCAAGAACTGGC
CGGTGCCTCGGACACAAGAAGAGCTTCACAGCTTTCTGGGCCTAACAGGCTACGTACAACGTTTCTGTCCGGAATGTGCTTCGTTGACGGCAACAATGTT
TGCTTTGTTGAAGAAGAGGAACAAGCGTAAATCCAAGATCCACTTCAGCGATGAGCAGCTGAAGAACTTCAATGAGTTGAAGCGACGCTTGTGTAATCCA
CCAGTACTGCGCTTGCCGGACTTCAGCAAACCAATGCACCTGCGTACCGATGCAAGTAAGTTCGCGGTTGGTGGTGTACTATTCCAAGTCATCGACGGTG
TCGAGCAACCCATTGCCTACACCAGTCGAAAGATGAAACCAGCGGAGTTAAACTACCCAACGCAGCAACAAGAACTTCTAGCGATTGTGCACGCGCTGGC
AGCTTTCCGAATTTACTGCTTGGATAAACCTCCAGTTATCGAAACTGATCACAAGAGTCTGGAAGGGATTTTCACTCAGAAGATGGCAAATCGTCGGTTG
GCACGGTGGTACGACATTACCAACCACAATTCTCGTATCTGCCTGGAGCGCAAAACGGAATTGCTGACGCCCTGAGTCGACGTCCAGATTTGCAGCCGGA
GACGAAGTACTTTCATGACTTAAGTGTTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCGATCACAACGGACAGCGAGCTAATCCAGTCG
ATTAAAACCGCGTACGCCAAAGATCGAGAAGCTCAAGCGATATTCGATGCTATCCGAAGGCGACGTGAAAGTACGAGCAAGCGTGTCGACCGTCAGCACC
GGAAGAAGTATCGGTGTTACCATGAAGATCGTGGACTGCTGTGGTATCAGACAACCAGCGATGACACACCTCGTGTAGTCGTACCAAACTCGGTCAAGGT
TCGTCAACAGATCATCAGCGAATGCCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATATCTCACACTGTCACGTCACTGGTATTGGACC
AAGATGATCAAATCCATCCAGAAGTTCATCGCTGACTGTGAACCGTGTCGAAGAAATAAACCTCGGCTGACCAAGCCACCAGGACTGTTGGAACCGCTTA
GTATTCCTGAGGAGAGATGGCGATCAATCTCCATGGATTTCATAACAGACCTGCCCCGTTCTGCACGGAAAGTGGATTCAATTTGGGTTGTCGTGGATCG
CTTGACGAAGAGATGTCATTTTGTGCCAACAACCAAGACGGTAACTGCTGAAAGTGTTGCTCGTTTGTTCGTGGAGAACATCTGGAAGCTTCACGGAATG
CCTACAAGCATAATCTCTGATCGAGACCGTAAGTTTGTGTCTTATTTCTGGCAATACGTCTTCAAATCAATTGGAACGAGCCTGAAGATGACAGTCGCTC
ACCGAGCACAGGGTGATGGCCAAACCGAACGGATGAATCGGACCTTGGAGGAGTATCTGCGTTGCTTCGTGGGACCACGGCAAGACGATTGGGACGTGCA
TCTCGCGAATACCGAGTTT