Description :
From Genome Similarity Track
Location :
contig_6:174201- 177992
Transcript NameFunction/comments
g1793.t1tRNA pseudouridine(38-40) synthase
g1794.t1hypothetical protein PHMEG_0002980
g1795.t1Ubiquitin conjugating enzyme E2 B

Sequence
3791 bases(100 bases per row)
GACCATGAGCGGCGAGGACGTGTCCGTCGTGGTGCCTGCACGCCACCGCTACTGCCTGCATATTGCCTACTATGGGACGGACTTCGTGGGTGGCAACGGC
AGCAGCAAGAGGACAAAAGCAGCTCGGGCCACGACAGCGTACAGGAAGTCGTGGAAAAGGCCGTAACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACGT
CACGGGCGTCAGTCGCACGGACGCAGGGACCCACGCGCTCTACGTAGGGTCTGATGAAGTGAAACGAGAATTGTCCGAGTCGGGTTTGCACTAAAAGGTG
ACTGTGAATGGGTTTCCGTAGCAATTCGGCTTCATTCGTCTGCACTCAGAGCTGTCGATGTCGCTGGACGAGTTGAAGGACAGAGTCAATGCCAAGTGCG
TGGGGAGTAGTTTGGAGAGTGATGCTGCAGTCTGTGGTTGATGGATTTTGTGTTGTGGCAGACTGGGGAGTGGGCGAATCGAGGTGCTTGGGGTGACGGT
GCCGACGACGGGTCCGTCGCGGATTCGGTCGCGCTGCAAGAAGTACATTTACTATCTGCAGCAAGGCCACCGACCGGATCTGGAGCTGGGCAAGTACTCG
TGGTTCCTGGGCAGACGACTGAGTATTGAGCGGATTCGAGACGCGCTCAAGTGAGTGGGAGATGGTGCTTTGCTTTAGTTGACAAGAAGCCTGACCTGCT
GTTGCTGTACTCGGTAGGCTTTTGGAGGGCACGCACGACTTCCGGCCCTTCTCGCAGGGTCTGCTCAAATACCAGGACATGGCGACTGTGCGGACGATCA
TTTCAACCAAGGTGGTTGTTCGACGGTACGCCCACTTCTTCACGCACCACTCACAGATGCAGCACACGTCTAAAAGCTTTTACTTGGTGTTGGTAGGAAC
GTAAACTTTTCGCTGGATCCGCAAATGTGCGGCAGTGGGGAGATCATCGATGCTGCTGACATGTACCTCGACACGCCGGTCGGAACAACCTCTGAGCAGC
ACAATTCGGATGGTAGCAAGGTCGTTGCGACGGAGCATCATCACAAGAAGCGGAAGTGGAGGAGGCTAAAGGAACTACGCCTGTACACTTCGTCTGTATT
GAGCTCGTCGCCAACGGATTTCTTCGGCACATGGTGCGCCGCATCATTGGAACGCTGCGTCCAATTGGGGAAGGTACCCAGCCACCGTCGCGAATGCAGC
AAGTTCTAGCAGGTGTGGTCCAGCCAGGGCCTTCCGCTCCAACAAAAGCTCTTTGGCTGCATCGCACTTGGCTGACGCAAGAAGAGTACGACGCGGATTG
TACTACCGAAGACTAGAGTACCATTGTTGCAGCGATAAGATACAGTGCCGACTTGCTGGCACTGCTACTCCATTCACTCGCGCCTTCATTCATTGATCTA
TAGCTCTTCGTGGGCACCTGCGGATGCAACAGCTTCTTCCTGCGCAGCAACAATTTCCAAGATCCGAGTGATGTGCTCCAGGATGATCTCTCCAACGATT
TCTGGAGAGTATTTGGCCACCATGTCTTCTCTCGCTTGCTTGCCTTTCCCCGCTGCTTCCTGCAATAGCAACAAGCCCTAGCGTCAGAATTCAAAGTGCG
AAGAGGAATCACAGTTCATACACCGTACCTCAGGGAACTCCTTCACACGAAGCAGCAACTCTTTCAGATGCTCCACAGAGGGATCGGCCCACATGTGACC
TCGAAATGCTCCTTCTGTAATCTACACGAACATCCAAAGGCACTCAGCCACACACACACACACACACACAAGTTGCTGGCAGTGCGCTTAAGCTTACCTC
AATGAGTCCGTCAATCTTGAGCGGGTACGAGTTTTCTTCCGTCATGTATTCCGTAGTGCCGCTCCAAAAAGTAGCAATCACAGGCCGCTCCATGGCCATG
GCCTCGACATGCGGTCGGCCCCACCCTTCGCCACGCGACGGCAGGACAAACGCGTTCGCAGCCTTGTACAAGGCCGGCATGGCCTCTTGCGGGATATGCG
GTGGCAACACGTGAAGGTGCGGCAGCTCATGAAGCTTCTTGCCCACGGCTTCTACCGCAAATTCCTCAATTTTGTTCAAAAAGTCACCGGCCGACGACGA
TGAGCTGTGATACCCATTCGTCAGCAGCACCAGCACCACGTCCTCATGTGCCTCGAAAGCCTGGAAGTAGGCCGTCAACAAGACCTTCCACGCCTTCCTC
TCCTCCCACTTGAAAATGGACAGGTACACGGTCGTGTGCTCCGTCAGCTCAAACTGCGTCTCGCTCGCTAGATCGTACGGCGTCTCCACCTTCTCGGGGT
CAAAGAATGCCACATCCACCACCTCGGGCACGACCTTGACCGCTTCTGGTCTCACTCCTCCATCCACGAAAACCTTCTCCTGGAACTTGGTGGGCACCCA
GATCTCGTGCATCTTGTTCATCCTGTCGGGCCACCCTTGGGGCACTCTGTCCGTCTCGAACATAGTCCGTCCGACTGTGTACAGCGCCCCACCGGAGGAC
ACTTGGACGTCATGTAGTGGGCGGGCTCCCATGCTCCAGGTTCCGAGTGGCAGATGGCGAGCGCGATTTTCCGGTGCTGTAGCCGCCAGGAAACGTCCCG
TTCCTGGATCCAGTGCAGCTCCAGCGTCGACTTCATGCCCTCCGACAGGTCCTGGATGAACGACGGGTTCAGTGAGTCCCCGTGCTGCGTGATCAGCAGC
TCAAAAGGCTGCTCCGGCATTGCGTCGCTCTGTTCGGCAGCTTCTGCTTGGCTAGAGGCGGAAATGGAGCGTTTTGGGGCAGATTTCGACCAAGAATCGA
GCGCGGCGTCAACTGCCACTACGTAGGACTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGCGCATACCACAATACAGCAGGAGGTCCCGCTTC
ACTGCTGGCGGCGGCACGACGCCCGAAAGCGGCTGTGGACGGCACTAGCAGTGCACACAGCGAGCAAGAGGTGCATCATCTTGTTAGCACTACGGATCGA
AATGTCAAGTTTGGATGATAATTGTTGGGGAAATGTCAGGTTAGGTTCGGAAAATGTCATGTTTGGATGATAATTTTTGGAAATGCTGTGCGAGACCATC
ATGGCTGACCTAAAGTTAGGACGCATACTGGTTGGTCCAGTCCTGCGCCGTCTTGTCGAAGTCGGCCTTGTTCTCGTGCATCTGCTTGGCGATCTCTGGC
TCCAGGGGGTTGTCCATGTCTGGCTGCTCCAGGATCTGCTTGATGGCAGTGAGGCAGTGCATCACGTTGAGCGTCGGGCCCCAGTTCTGCAGCGACAATA
GCGACAATAGCAATAGCAGTAACTAATGAGTCATCAACATATCTCAACCTGCTACTGCTACTGCACGCACCTCGTTGATGATGTCGGCGCAGATCTCACC
CGACTGCGACTTGACGTTCGGGTGGTACACGCGCGTGAGGAAGCGCACTTTGGGAGCCTTGAACGGGTACTCGCTCGGAAACTGCAGGTCCAAGTTGAAG
ACGCCGCCCGAGTACGGCGAGTTCTCCTGCAACAGCAACACAACCAGTGAGCTCAAGGGCCTCTCTACAGTCTTCTCTATTGGTGCCACGTACGGGGCCG
GCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACTGTGCACCAGTCGGGCGAACTCTTCTCAAACTCGGCGAGTTCCTACAGCAGAC
ACTCGATTAGTACGCGGTCGGGTCGAGTGCCTTGTAGATGGACGCACCTTAGTGAGACGGCGAGCCATGATCTACAGGCTGAGGAGAAGGA