Description :
From Genome Similarity Track
Location :
scaffold_90:17420- 19253
Sequence
1833 bases(100 bases per row)
GagatagccatcttgctttAGTCGAAGATCGATTCAGCGGAACTACGCTcatatcagttttggatgatTCGGCTCTCGAATAATTTTGAAAGCGTGTGGA
CCACGCAGAGAATCTGCTATTTCGAACGGTTTAACTGATTCTTATCATTCACTTTGTTTTGGAATACAAGGATGACGTCCTTAGTGCAAACTCGCCCTCT
GACATTCGACCCGAACGGGAAATCGACACGAAATTGATCGTGAACCTGGTTCAAAGCATGTTTTGCTTTGCCAAAGTCCACTGTCGCTTGGGCTAAGTAA
GTATATCGATAAGCTTTTTAACTAAGAGCAAGCAGCTGGTTTGGTTAGGGAGAGTAAGTCCCCTGACTGCACGccgacgttttgtgtgcgtGCACCCAGC
GAGAAATGGCGTAACGCTCACGTCTAAAACAAGACAATTGCGCTGGCGATTCCCTCTCAAACACCGATTCCGCGTAAAGATGTCATCATATACCGTATGT
TCGACTGTACACAGTTTAGTGTACTTGATATAGTTGATCGATATCACCAGTGAGGAGGACATCTCTTTGACGGCTGTTAGTGCACCATCCGGCATATCCC
GGGAGTGGCTTGTCTATCCAATGCCCCGGTAGCGTTCAGTCGATAGGATTTCCATCTGTTTCAGCCACTGCGAAGCTTTATGCAGACATATTTTGCAATA
TTTTTGTCATTCGAAGGGCGAAAATGGCAAATCTGCCAAAGAAATGCACTTGGAGCAACTATATCAAGTGGTAGAATGTATGCGTGAACATTAATTGCAA
TAGGGAATTTTGCAAAGTGAAAATTCAGTGCTAACGAAGTACTGGGCCTCGGTTGTTATGTTGGTAACCGCGTTGCTCGTACAGACCCTGAATAGGTCAA
ATCAATCGTGGATTGGCCAATCGCGCCGAGATAATACATTTGTGAAAATGGATTAGTTTGTCCAATTACCTGCGTCGCTTCTTGCGTTACTAAGCGGTAA
TGGTATACCCACTATCGGACTTGATAAAAAAGGACTTATTCTGATACTAGTCATTCACTTGTGACGAAGCGCTCACTCAAATCACGAACGGTTTGATGAA
GCACCATCACTTGCTTTACAAGCCGTATAGCGTCGTGTGTGTCGTCTATATTTGCAATCGGAAGCGCACTATTACAAGCGAACTTAGAAGGGCACGATCG
TATCGTTTTTATTCACAACAGCTAAAGACAACAATAAAGAACTATACTGCCCATGACAAGGATCTtttggcaatgaagtataTTCTGGTAAGGTTTCGTG
TTCGCCTCTTAGGTTCAACTCCGTTTGTCATCTACGCAGATCACACAATCTTGCGATATGCAGTTCAGTCTCCTCACTCATCTTAGCGGACAGCTTGCTG
GCTGTCAATATTCGCAGAATGCAACTTCGAGGTCACGTACCGGCCAGGAATTGAACGTGCTGGCTAAAGCATTGCCACGTCGTCCTGATTAAGAGTTTGC
CATTTTAGCTATATCAAAATCGATGTATTCGATAGGATATGTCGAGCCTGTGTTGAGTTAGAACAGTGTGATCCGATCATTAAGTCACTCACATCGAGTG
ATATGGAACTCCATGACAAGCTTCTTGGTCGTTTCGCATCGCAGAATGGTCTCCTTTACTATGAAGTTGCACATACGACGAGCCACAGACTGTTGCTCCC
CACAACGATAATTTCAAGTGCAAGATCGTGTACGAGGCATATGATACGCTGATGGCCGGTCACTGTGGCCTTGAGAAAACCTACCAGCCTCTTAGGGCTC
AATTACAGAGGCCCACCCCATGTACAAGTGGGT